User: ruiyan_hou

gravatar for ruiyan_hou
ruiyan_hou0
Reputation:
0
Status:
New User
Last seen:
19 hours ago
Joined:
4 months ago
Email:
r*********@163.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by ruiyan_hou

<prev • 7 results • page 1 of 1 • next >
0
votes
0
answers
56
views
0
answers
Comment: C: how to get a new fastq file according to their barcodes?
... Thank you. I have a scRNA-seq that contains three cell lines artificially mixing. I just want to get fastq of one of them. Now, I get these cell lines barcodes. I want to get the fastq file that just contains this kind of cell line. How should I do to get them? thank you! ...
written 4 days ago by ruiyan_hou0
0
votes
0
answers
56
views
0
answers
how to get a new fastq file according to their barcodes?
... hi, everybody, I have a question to ask. Hope to get your help and thank you. I have a set scRNA-seq data (10×). It includes two reads. Reads 1 contain the UMI and barcode, just like follows: @SRR7646180.1 1 length=26 GTCGTAAAGATATACGGCACAACTCT +SRR7646180.1 1 length=26 CDDDDIIIIIH ...
rna-seq written 4 days ago by ruiyan_hou0
0
votes
0
answers
124
views
0
answers
Where can I get the 10 Genomic scRNAseq of k562 cell line and HepG2 cell line data?
... Hi, I really want to get scRNA-seq of k562 cell line and HepG2 cell line in 10× Genomic platform. It is important for me. However, I spent 3 days to search them and I have not found any one in literature. Can anyone see the relevant datasets? Thank you in advance!!! ...
rna-seq written 3 months ago by ruiyan_hou0
0
votes
1
answer
216
views
1
answers
Comment: C: How to get different isoform's counts in different cell by using alevin (salmon
... I appreciate your help very much !!! ...
written 3 months ago by ruiyan_hou0
0
votes
1
answer
216
views
1
answers
Comment: C: How to get different isoform's counts in different cell by using alevin (salmon
... OK, thank you very much! ...
written 3 months ago by ruiyan_hou0
3
votes
1
answer
216
views
1
answer
How to get different isoform's counts in different cell by using alevin (salmon)?
... Hi, I have some 10× genomics scRNA-seq data. I use alevin to compare them to transcriptome. I want to get different isoform's count . However, when I use the following code, I got the CB × gene_id matrix. How can I get CB× transcript_id ? Thank you in advance. nohup salmon alevin -l ISR \ ...
rna-seq written 3 months ago by ruiyan_hou0 • updated 3 months ago by Rob4.5k
0
votes
2
answers
724
views
2
answers
Answer: A: STAR error: EXITING because of FATAL ERROR in reads input: short read sequence l
... Hi, I think you can check the length of your reads after cutting adapter. If your one pair read's length is not equal , this error may happen. ...
written 4 months ago by ruiyan_hou0

Latest awards to ruiyan_hou

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2001 users visited in the last hour