User: projetoic

gravatar for projetoic
projetoic0
Reputation:
0
Status:
New User
Last seen:
20 hours ago
Joined:
3 months, 3 weeks ago
Email:
p********@hotmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by projetoic

<prev • 28 results • page 1 of 3 • next >
0
votes
0
answers
39
views
0
answers
Relative frequency. Where's the error?
... those are the data Phe UUU 1483 1.14 Ser UCU 1094 1.47 Tyr UAU 1000 1.12 Cys UGU 434 1.18 UUC 1117 0.86 UCC 773 1.04 UAC 789 0.88 UGC 303 0.82 Leu UUA 1349 1.55 UCA 882 1.19 TER UAA 47 1.27 TER UGA 36 0.97 UUG 1549 1.78 UCG 487 0.66 UAG ...
gene genome sequencing rna-seq assembly written 3 days ago by projetoic0
0
votes
0
answers
58
views
0
answers
Relative frequency with python
... What is the best way to calculate as relative frequencies (value / total value) from a list of tables with absolute values? Phe UUU 1483 1.14 Ser UCU 1094 1.47 Tyr UAU 1000 1.12 Cys UGU 434 1.18 UUC 1117 0.86 UCC 773 1.04 UAC 789 0.88 UGC 303 0.82 Leu UUA 1349 1.5 ...
gene R sequence software error genome written 4 days ago by projetoic0
0
votes
2
answers
219
views
2
answers
Comment: C: How to count the number of codons in a frame or order using the equation?
... Thanks! ;) ...
written 7 weeks ago by projetoic0
0
votes
2
answers
219
views
2
answers
Comment: C: How to count the number of codons in a frame or order using the equation?
... valueConversion = {'T': 1, 'U': 1, 'C': 2, 'A': 3, 'G': 4} def customHash(codon): P1 = valueConversion[codon[0].upper()] P2 = valueConversion[codon[1].upper()] P3 = valueConversion[codon[2].upper()] return ((P1 - 1)*16) + P2 + ((P3-1)*4) - 1 # Note the c ...
written 7 weeks ago by projetoic0
0
votes
2
answers
219
views
2
answers
Comment: C: How to count the number of codons in a frame or order using the equation?
... It is: syntax error at -e line 2, near ">" syntax error at -e line 3, near ""[$final]" }" Execution of -e aborted due to compilation errors. What do these errors mean? I can't see the exit/output... ...
written 7 weeks ago by projetoic0
0
votes
2
answers
219
views
2
answers
Comment: C: How to count the number of codons in a frame or order using the equation?
... ok. Thanks! :) ...
written 7 weeks ago by projetoic0
0
votes
2
answers
219
views
2
answers
Comment: C: How to count the number of codons in a frame or order using the equation?
... #Script para contar códons someSequence = 'atguuucccggggtataaggcaaaa' d = dict() for idx in range(0, len(someSequence), 3): codon = someSequence[idx:idx+3].upper() if codon not in d: d[codon] = 0 d[codon] += 1 for codon, cnt in d.item ...
written 7 weeks ago by projetoic0
4
votes
2
answers
219
views
2
answers
How to count the number of codons in a frame or order using the equation?
... Let's consider these values T/U=1, C=2, A=3, G=4 And that order: enter image description here The input is a file.fasta that has the following data: >id atgatg I will open and read the file and I will analyze it every three characters First analysis starts with atg ... Then I ap ...
python biopython code written 7 weeks ago by projetoic0 • updated 7 weeks ago by Jorge Amigo12k
2
votes
1
answer
148
views
1
answer
Interpretation of code snippet.
... I'm not able to understand what this excerpt means ... Does he say he can modify the genetic code? As written above, each is a method of the codonw`.CononSeq object,` e.g. import codonw cseq = codonw.CodonSeq("ATGAATATGCTCATTGTCGGTAGAGTTGTTGCTAGTGTTGGGGGAAGCGGACTTCAAACG") cseq.cai() T ...
gene python code documentation written 7 weeks ago by projetoic0 • updated 7 weeks ago by h.mon32k
0
votes
0
answers
104
views
0
answers
Tools to find similarity and identity via terminal or ubuntu
... Which tools to find similarity and identity via terminal or ubuntu, more complete and with better results? What are the tools to have a quality control of the alignments? That can run from the command line ...
genome alignment bash sequencing linux written 8 weeks ago by projetoic0

Latest awards to projetoic

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2557 users visited in the last hour
_