User: yaqinguo629

gravatar for yaqinguo629
Reputation:
0
Status:
New User
Last seen:
1 month, 1 week ago
Joined:
1 month, 3 weeks ago
Email:
y**********@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by yaqinguo629

<prev • 12 results • page 1 of 2 • next >
0
votes
0
answers
76
views
0
answers
How to estimate the running time when using CIPRES ?
... Hi, everyone. I have a problem with CIPRES web-portal. I alway got this problem, even though I already increase time from default time (0.25h) to 3h. Below is the email I received: Your job run named 'all-see_1' has terminated. You can view the results of the run at CIPRES Your CIPRES job NG ...
alignment next-gen sequence written 5 weeks ago by yaqinguo6290
0
votes
7
answers
24k
views
7
answers
Comment: C: how to convert a long fasta-file into many separate single fasta sequences
... Here is the answer that I got, I hope to help novices: 1:first step to spilt into each file cat *.fasta |\ awk '/^>/ {if(N>0) printf("\n"); printf("%s\n",$0);++N;next;} { printf("%s",$0);} END {printf("\n");}' |\ split -l 2 - OTU 2:second step to add extension for ...
written 5 weeks ago by yaqinguo6290
0
votes
7
answers
24k
views
7
answers
Comment: C: how to convert a long fasta-file into many separate single fasta sequences
... This one could spilt a big file into each, but I would like use the header name as each file name, is that possible? For example: here is a big file: >OTU1 ATCGATCGATCGTCGATCG ... >OTU1000 TCGATCGTCGATCGTCGATCGTCGATCG The output should be like this: OTU1.fas ...
written 5 weeks ago by yaqinguo6290
0
votes
0
answers
83
views
0
answers
(Closed) how to convert a big fasta file into several smaller one
... Hi, everyone. I have a big fasta file as below: >OTU1 ATCGAATTCGATCGAATTCG >OTU2 TTCGAATTCGCCATATCGAATTCG ... >OTU800 ATCGAATTCGATCGAATTCGATCGAATTCG I want to put each sequence into the fasta file, like this: OTU1.fasta OTU2.fasta ... OTU8 ...
next-gen sequencing written 5 weeks ago by yaqinguo6290
0
votes
1
answer
149
views
1
answers
Comment: C: how to change header of fasta file
... Thanks for informing me this. Again, thank for your help! ...
written 5 weeks ago by yaqinguo6290
1
vote
1
answer
149
views
1
answers
Answer: A: how to change header of fasta file
... awk '/^>/{print ">ASV" ++i; next}{print}' < file.fasta this one works perfectly for this kind of issue. Thanks for your both @Medhat and @RamRS ...
written 6 weeks ago by yaqinguo6290 • updated 6 weeks ago by _r_am31k
1
vote
1
answer
149
views
1
answer
how to change header of fasta file
... Hello all, I have the following fasta file, but I want to change the header, please give mea hint, Thanks a lot >7a11faf04904a091a0150f1de2091c13 GATCGAAGGAATCGGTCCGCCGTCA >f04f5b529914f21e583996fbe22db642 GGACCTGGCCGGGCGGTCCGCTTTACGGCGTG ... ... >503af07882c049 ...
sequence next-gen written 6 weeks ago by yaqinguo6290
0
votes
1
answer
197
views
1
answers
Comment: C: how to add > to fasta file header and merge two line headers into one line(see b
... Yes, Sure. When I figured it out all. I will do summary and it's better to check it for others. But `$ cat test.fa` this command just get the same sequences with what I have, this can't remove space between each line. I used following command to remove the line break: $ awk NR%2==1 test.fa ...
written 6 weeks ago by yaqinguo6290 • updated 6 weeks ago by _r_am31k
0
votes
1
answer
197
views
1
answers
Comment: C: how to add > to fasta file header and merge two line headers into one line(see b
... MT657978 AAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAATTTC AB626044 ACATACGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAA Hello, everyone. If the sequences look like this, this is another story. How to add `>` to the header and remove space? using before script, ...
written 6 weeks ago by yaqinguo6290 • updated 6 weeks ago by _r_am31k
0
votes
1
answer
197
views
1
answers
Comment: C: how to add > to fasta file header and merge two line headers into one line(see b
... I GOT IT. THANKS VERY MUCH! ID #NEW LINES# SEQUENCES #NEW LINES# ID #NEW LINES# SEQUENCES SEQUENCES #NEW LINES# ...
written 7 weeks ago by yaqinguo6290

Latest awards to yaqinguo629

Scholar 5 weeks ago, created an answer that has been accepted. For A: how to change header of fasta file

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1316 users visited in the last hour