User: zeleniy.spb

gravatar for zeleniy.spb
zeleniy.spb30
Reputation:
30
Status:
New User
Location:
Last seen:
5 years, 5 months ago
Joined:
6 years, 4 months ago
Email:
z**********@gmail.com

about me

Posts by zeleniy.spb

<prev • 5 results • page 1 of 1 • next >
0
votes
2
answers
1.7k
views
2
answers
How To Determine How Many Strains Of Ecoli In Metagenome
... I have a human gut whole genome metagenomics reads. And i must answer the question - is there only one or several ecoli strains in it. How can i do it? ...
metagenomics written 6.0 years ago by zeleniy.spb30 • updated 6.0 years ago by Manu Prestat3.9k
1
vote
0
answers
1.9k
views
0
answers
How To Assemble Genome Generated With Bac Clones?
... I have 2 fastq files from illimina with reads length 250b. Sequences from one file obtained by sequencing from "right" and from "left" in another. This is paired end sequencing. As it is whole genome shotgun technique, both fastq files comprise vector sequence, target sequnce in BAC, ecoli DNA and m ...
illumina paired-end written 6.2 years ago by zeleniy.spb30
0
votes
1
answer
1.4k
views
1
answers
Answer: A: What Is Sff_Extract Output Fastq File Format?
... You can detect type of fastq format using fastqc or DetermineFastqQualityEncoding.pl script: $ perl DetermineFastqQualityEncoding.pl r05_in.iontor.fastq sampling.. observed range: 34-76 format: Sanger or Illumina 1.9+ (offset by 33) ...
written 6.4 years ago by zeleniy.spb30
0
votes
1
answer
1.4k
views
1
answer
What Is Sff_Extract Output Fastq File Format?
... Refer to this document what is sff_extract output fastq file format? ...
fastq written 6.4 years ago by zeleniy.spb30
10
votes
6
answers
3.1k
views
6 follow
6
answers
Is There Is Tool For Variable Tandem Repeats Finding?
... For example i have the next sequnce: ACGAGGTTACTACTACTAGTACTACGCC As you can see there is a tandem repeat with monomer TAC. But because of mutation one monomer now is TAG and, for example, exact-tandems tool cannot recognise TACTACTACTAGTACTAC as one repeat. So how can i identify TACTACTACTAGTACTAC ...
written 6.4 years ago by zeleniy.spb30 • updated 7 months ago by kashiff00780

Latest awards to zeleniy.spb

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2127 users visited in the last hour