User: mthm

gravatar for mthm
mthm10
Reputation:
10
Status:
New User
Location:
Last seen:
7 hours ago
Joined:
1 month, 2 weeks ago
Email:
m************@gmail.com

Posts by mthm

<prev • 8 results • page 1 of 1 • next >
1
vote
0
answers
54
views
0
answers
Error: mysql table already exists! Is it safe to delete the tables in mysql manually?
... I have tried to run `CreateGFF3sForClassifFeatures.py` in REPET pipeline once before. then,for some reason I removed the whole directory and tried to re-run the script, but because I ran it before, the data files have already been created in mysql and apparently are not re-writable! problem is that ...
mysql written 2 days ago by mthm10
0
votes
0
answers
49
views
0
answers
TEdenovo blasting with Recon perpetuates..!
... I have already ran one whole cycle of TEdevono (S1-S8) on one of my samples successfully, when starting to run the second sample, the `-S 3 -s Blaster -c Recon` gets stuck at this step, without returning an error or any output file, last time I let it be for almost 3 days but it was still at the ...
repet tedenovo te written 8 days ago by mthm10
0
votes
1
answer
3.3k
views
1
answers
Comment: C: Python script to remove sequences from a fasta file
... thanks I realized my mistake after posting it, but was too late:) I thought this issue is too minor to be posted separately, sorry. ...
written 14 days ago by mthm10
0
votes
1
answer
3.3k
views
1
answers
Comment: A: Python script to remove sequences from a fasta file
... Hi, I tried to run this script but it returns this error: fasta_file = sys.argv[1] # Input fasta file IndexError: list index out of range should the fasta file be of special format? mine starts like this: >monCan3F9-B-G1013-Map20 ATACAACCACTAACCAAACAACATATAGACTG ...
written 14 days ago by mthm10
0
votes
1
answer
147
views
1
answers
Answer: A: How to build and use a RepeatMasker custom library inside the singularity contai
... since this is a very new approach, I am going to explain it here, it might help others in future. the new version of RepeatMasker-4.1.1 doesn't have the old "queryRepeatDatabase" option instead you should use "famdb.py" first you need to enter the singularity shell; navigate to the directory where ...
written 26 days ago by mthm10
2
votes
1
answer
98
views
1
answers
Answer: A: TEdenovo Blaster step 2 raise an error :Exception: ERROR when launching 'LaunchB
... I think the reason was the "copy" option inside the TEdenovo.cnfg file which was "yes", although I had defined the tempdir path for it, apparently it didn't work properly, once I changed the copy option on "no" the step 2 of Blaster analysis was finished successfully. ...
written 26 days ago by mthm10
2
votes
1
answer
98
views
1
answer
TEdenovo Blaster step 2 raise an error :Exception: ERROR when launching 'LaunchBlasterInParallel.py
... I am running a TEdenovo analysis in the docker container where the REPET pipeline is installed on it with all the dependencies. when running the step 2 sequence blasting analysis; TEdenovo.py -P DmelChr4 -C TEdenovo.cfg -S 2 -s Blaster I receive this error at the end: START TEdenovo.py (2 ...
tedenovo te docker repet written 27 days ago by mthm10
0
votes
1
answer
147
views
1
answer
How to build and use a RepeatMasker custom library inside the singularity container?
... I have installed the Repeatmodeler v2 singularity container as a Dfam TE Tools which includes RepeatMasker and I have merged the RepBase library to the RMasker library using below instruction: > # Navigate to an appropriate directory that is persistent outside the container $ cd /work & ...
te singularity container repeat written 29 days ago by mthm10

Latest awards to mthm

Scholar 26 days ago, created an answer that has been accepted. For A: TEdenovo Blaster step 2 raise an error :Exception: ERROR when launching 'LaunchB

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2805 users visited in the last hour
_