User: hbr721

gravatar for hbr721
hbr7210
Reputation:
0
Status:
New User
Last seen:
5 years, 8 months ago
Joined:
5 years, 10 months ago
Email:
h*****@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by hbr721

<prev • 7 results • page 1 of 1 • next >
0
votes
0
answers
3.1k
views
0
answers
Comment: C: Fasta Sequences Alignment And Find Out Gene Biotype Particularly The Non Coding
... Thanks - I finally found the annotation file, but unfortunately it has the biotype information only for the gene of interest but not for the opposite strands. Thanks though - I did learn lot. ...
written 5.8 years ago by hbr7210
0
votes
2
answers
4.6k
views
2
answers
Comment: C: How One Can Separate Noncoding From Coding Ucsc And Ensembl Transcripts
... Great !!! thanks so much. Currently i am trying to see the reverse strand information from the Blat output, if i can't then i have to switch to perl api. ...
written 5.8 years ago by hbr7210
0
votes
0
answers
3.1k
views
0
answers
Comment: C: Fasta Sequences Alignment And Find Out Gene Biotype Particularly The Non Coding
... Thanks for your reply. Unfortunately I could not locate the corresponding annotation for probes - would you be able to point to the link please. ...
written 5.8 years ago by hbr7210
0
votes
2
answers
4.6k
views
2
answers
Comment: C: How One Can Separate Noncoding From Coding Ucsc And Ensembl Transcripts
... I am sorry that my question was not clear. But still you got it right - yes I am indeed interesting in looking on the non coding genes on the opposite strand of my gene of interest. I will look into Perl API. Thanks again. ...
written 5.8 years ago by hbr7210
0
votes
0
answers
3.1k
views
0
answers
Comment: C: Fasta Sequences Alignment And Find Out Gene Biotype Particularly The Non Coding
... Thanks for your reply. Yes you are correct, they are indeed microarray IDs and probe sequences, may I know which annotation I can find the gene biotype information. Moreover I have thousands of these gene lists, and I need to find the gene biotype information on both the sense and antisense, hence I ...
written 5.8 years ago by hbr7210
0
votes
2
answers
4.6k
views
2
answers
Comment: C: How One Can Separate Noncoding From Coding Ucsc And Ensembl Transcripts
... Using Ensembl biomart, is it possible to find gene biotype on the opposite(antisense) strands, especially if it is coding and non-coding. ...
written 5.8 years ago by hbr7210
1
vote
0
answers
3.1k
views
0
answers
Fasta Sequences Alignment And Find Out Gene Biotype Particularly The Non Coding Type
... Thanks for looking into this post. I have a file that has fasta sequences in this format >A_42_P574859 AAGGAAGCGAGACACCAACTTCCCCATATGCCTCTTCTGCTGTAAATGCTGTAAGAATTC >A_43_P11616 TCTGTGAAATCCTCAGTGTTCAATCCAGACTCAGTAGTATATTACAGTTTTCTGTAAGAG >A_42_P681722 TTAGTTTAAGACTGTATGTACTGTAT ...
gene written 5.8 years ago by hbr7210 • updated 5.8 years ago by Pierre Lindenbaum123k

Latest awards to hbr721

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1266 users visited in the last hour