User: Na Sed

gravatar for Na Sed
Na Sed280
Reputation:
280
Status:
Trusted
Location:
United States
Last seen:
10 months, 1 week ago
Joined:
6 years ago
Email:
n**********@yahoo.com

about me

Posts by Na Sed

<prev • 93 results • page 2 of 10 • next >
3
votes
0
answers
861
views
0
answers
Comment: C: How to calculate the number of genes has specific repeat on it?
... Please provide sample data. ...
written 3.4 years ago by Na Sed280
2
votes
1
answer
1.2k
views
1
answer
Need your help to check MsigDB (it takes less than a minute)
... In previous month I used to run the bellow code the gene sets from MSigDB database. But now I get an error. Unknown IO errorfailed to load external entity "http://www.broad.mit.edu/gsea/msigdb/cards/BIOCARTA_HDAC_PATHWAY.xml" Error: 'getBroadSets' failed to create gene sets: 1: Unknow ...
msigdb gsebase written 3.4 years ago by Na Sed280 • updated 3.1 years ago by Biostar ♦♦ 20
0
votes
0
answers
1.7k
views
0
answers
Comment: C: What is the format of *.contigs.fasta files?
... @Brian There is no '>' character in the file. Please see one of the file through the DropBox link: https://www.dropbox.com/s/2f1scrsgk0n2p4c/lbc26_ABCD.contigs.fasta?dl=0 ...
written 3.4 years ago by Na Sed280
0
votes
0
answers
1.7k
views
0
answers
Comment: C: What is the format of *.contigs.fasta files?
... In one line description of the file, it has been written that it is de novo assembled genome. In this case, what is the number of contigs? does it equal to the number of rows? ...
written 3.4 years ago by Na Sed280
0
votes
0
answers
1.7k
views
0
answers
Comment: C: What is the format of *.contigs.fasta files?
... What is the role of 'contigs' in the name of file? Also, I have only one file for each genome and the number of rows in this file is ~60,000 lines. All lines except the first line include A,C, G, and T. ...
written 3.4 years ago by Na Sed280
1
vote
0
answers
1.7k
views
0
answers
What is the format of *.contigs.fasta files?
... Hi everyone, I am given a file which its name is AA.contigs.fasta. The first lines of this file are like the below: >tig00000000 len=1940327 reads=4609 covStat=3434.17 gappedBases=no class=contig suggestRepeat=no suggestCircular=no ATCTGCTTCATCCGCATCGAATCACGGGCACTCAGATGATCTCTAGGGCACGACC ...
fasta next-gen contig written 3.4 years ago by Na Sed280 • updated 3.4 years ago by genomax78k
0
votes
1
answer
728
views
1
answers
Comment: C: Meaning of n in an equation of reaction in KEGG
... @Devon Ryan Thank you. Is this different from when the coefficient comes before the name of the compound? ...
written 3.5 years ago by Na Sed280
4
votes
1
answer
728
views
1
answer
Meaning of n in an equation of reaction in KEGG
... **G10477(n) + C00009 <=> G10477(n-1) + C00103** is a reaction in KEGG. You can find its page [here][1]. Could you please tell me what is the role/meaning of **n**? [1]: http://www.genome.jp/dbget-bin/www_bget?rn%20R06018 ...
reaction equation kegg written 3.5 years ago by Na Sed280 • updated 3.5 years ago by Devon Ryan94k
0
votes
0
answers
861
views
0
answers
Elementary Flux Modes in Reaction Network
... I am new in metabolic network analysis and elementary flux mode (EFM) concept. I just started reading the main paper in this field that dates back to 1994, entitled "[On elementary flux modes in biochemical reaction systems at steady-state][1]." In page 177, there is a matrix which the right-hand p ...
metabolic reaction elementary flux modes efm written 3.5 years ago by Na Sed280
0
votes
1
answer
1.3k
views
1
answers
Comment: C: Elementary Flux Modes
... @russhh I have the problem that you had 2 years ago. How did you figure out the problem? any book, paper do you recommend? ...
written 3.5 years ago by Na Sed280

Latest awards to Na Sed

Popular Question 11 months ago, created a question with more than 1,000 views. For Annotation in ExpressionSet object
Popular Question 16 months ago, created a question with more than 1,000 views. For Annotation in ExpressionSet object
Popular Question 21 months ago, created a question with more than 1,000 views. For Annotation in ExpressionSet object
Popular Question 21 months ago, created a question with more than 1,000 views. For Metabolic network database
Popular Question 21 months ago, created a question with more than 1,000 views. For Well-defined subtypes of cancers in TCGA database
Popular Question 22 months ago, created a question with more than 1,000 views. For Annotation in ExpressionSet object
Popular Question 23 months ago, created a question with more than 1,000 views. For Annotation in ExpressionSet object
Popular Question 2.3 years ago, created a question with more than 1,000 views. For Annotation in ExpressionSet object
Popular Question 2.3 years ago, created a question with more than 1,000 views. For Needed appropriate journal to submit my paper
Popular Question 2.3 years ago, created a question with more than 1,000 views. For What is the meaning of conservation site in miRNA-mRNA pairing context?
Popular Question 2.3 years ago, created a question with more than 1,000 views. For Log-transformed RNA-Seq data and linear regression
Popular Question 2.3 years ago, created a question with more than 1,000 views. For What is the interpretation of the obtained p-value here?
Popular Question 2.3 years ago, created a question with more than 1,000 views. For Annotation in ExpressionSet object
Popular Question 2.9 years ago, created a question with more than 1,000 views. For Annotation in ExpressionSet object
Popular Question 2.9 years ago, created a question with more than 1,000 views. For Log-transformed RNA-Seq data and linear regression
Popular Question 2.9 years ago, created a question with more than 1,000 views. For CNV data from TCGA
Popular Question 2.9 years ago, created a question with more than 1,000 views. For Selecting group of genes using sparse group lasso and CVX package in MATLAB
Popular Question 3.3 years ago, created a question with more than 1,000 views. For Log-transformed RNA-Seq data and linear regression
Popular Question 3.4 years ago, created a question with more than 1,000 views. For Is there anyway to get BioGrid gene interaction network automatically using R?
Commentator 3.4 years ago, created a comment with at least 3 up-votes. For C: How to calculate the number of genes has specific repeat on it?
Popular Question 3.5 years ago, created a question with more than 1,000 views. For Is there anyway to get BioGrid gene interaction network automatically using R?
Popular Question 3.6 years ago, created a question with more than 1,000 views. For Is there anyway to get BioGrid gene interaction network automatically using R?
Popular Question 3.8 years ago, created a question with more than 1,000 views. For Is there anyway to get BioGrid gene interaction network automatically using R?
Popular Question 3.9 years ago, created a question with more than 1,000 views. For Log-transformed RNA-Seq data and linear regression
Popular Question 3.9 years ago, created a question with more than 1,000 views. For Batch ID in TCGA database

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1045 users visited in the last hour