Entering edit mode
9.5 years ago
reeki
•
0
I have the following alignment file. How can I identify the SNP sites and how can I find the haplotypes. I know these are related but can't seem to apply it to the below data. Any help would be appreciate. If anyone can show me an example with just one of the rows or columns, that would be enough for me to figure out the rest.Thanks !
CLUSTAL W (1.81) multiple sequence alignment
seq1 gctgcatcagaagaggccatcaagcgcatcactgtacttctgccatggcc
Seq2 gctgtatcagaacaggccatcaagcgcatcactgtacttctgccatggcc
Seq3 gctgtatcagaacaggccatcaagcacctcactgtacttctgccatggac
Seq4 gctgcatcagaagaggccatcaagcacatcactgtccttctgccatggcc
Seq5 gctgcatcagaagaggccatcaagcacatcactgtccttctgccatggcc
Seq6 gctgtatcagaacaggccatcaagcgcatcactgtccttctgccatggcc
Seq7 gcggcatcagaagaggcgatcaagcacatcactgtccttctgccatggac
Seq8 gctgcatcagaagaggccatcaagcacatcactctacttctgccatggcc
Seq9 gctgtatcagaacaggccatcaagcgcatcactgtccttctgccatggcc
Seq10 gctgcatcagaagaggccatcaagcgcatcactctccttctgccatggcc
** * ******* **** ******* * ***** * ************ *