I'm new to docker technology, I'm trying to run the exceRpt small RNA pipeline. I've pulled the image rkitchen/excerpt .
rkitchen/excerpt latest 38fceb372de2 2 years ago 2.02GB
I want to call on the image for each fastq file in my data directory so I have a file called runexrpt with the following contet:
for i in /data/projects/0938_Feroz_Auyeung/test_fastq
do
echo $i
docker run -v /data/projects/0938_Feroz_Auyeung/test_fastq:/exceRptInput
\
-v /data/projects/0938_Feroz_Auyeung/excerptOuts_all:/exceRptOut
\
-v /data/genomes/exceRpt_hg38:/exceRpt_DB/hg38 \
-t rkitchen/excerpt \
INPUT_FILE_PATH=/exceRptInput/$(basename $i) \
ENDOGENOUS_LIB_PRIORITY=miRNA,tRNA,gencode,piRNA,circRNA \
MAIN_ORGANISM_GENOME_ID=hg38 \
ADAPTER_SEQ=AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC \
N_THREADS=20 \
JAVA_RAM=32G \
MIN_READ_LENGTH=12
done
echo "finished"
when I use docker run
runexrpt it tells me that the image doesn't exist, I understand that the error arises because the image I have is rkitchen/excerpt, so my question is how would I run this image so that all my fastq files in the fastq folder are passed through the rkitchen/excerpt image? Do I make the above chunk of code into a new docker image using the docker build command and run that to make the container that will pass all fastq files into the pipeline and give me all their outputs?
any help/guidance would be appreciated, thank you!