I'm running pindel on a paired end bam file done with bwa 0.6.2. The pindel version is 0.2.4t. However it segfaults after running for a while. Following is the last lines from stdout
Looking at chromosome chrX bases 0 to 5000000.
alignment-sorted.bam RP 158
Discovery RP: 158
sorting RP complete.
Modify RP complete.
InterChr RP reads: 5262
adding chrX 1403616 - chrX 1407348 - to breakdancer events. 3732 Support: 9
adding chrX 1407348 - chrX 1403604 - to breakdancer events. 3744 Support: 14
summarize BP as BD complete. Now start sorting BD...
sorting BD... done.
Added BreakDancer-like events: 744
Insertsize in config: 265
Number of problematic reads in current window: 27541, + 13819 - 13722
Number of split-reads where the close end could be mapped: 9180, + 4497 - 4682
Number of hanging reads (no close end mapped): 18361, + 9322 - 9040
Percentage of problematic reads with close end mapped: + 32.54% - 34.12%
BAM file index 0
Bam file name alignment-sorted.bam
Number of split-reads so far 9180
There are 68893 reads supporting the reference allele.
There are 1 samples.
SampleName2Index done
declaring g_RefCoverageRegion for 1 samples and 5000001 positions.
declare g_RefCoverageRegion done
update g_RefCoverageRegion done
There are 9180 split-reads for this chromosome region.
Far end searching completed for this window.
Reads already used: 0
Far ends already mapped 7449
Checksum of far ends: 519700800
Searching some type of variant, replace this with the correct name in child class ...
gdb -c core pindel gives out following in list
#0 0x00000000004054fe in GetRealStart4Deletion (TheInput=
'N' <repeats 160000 times>, "CTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTCTGAAAGTGGACCTATCAGCAGGATGTGGGTGGGAGCAGATTAGAGAATAAAAGCAGACTGCCTGAGCCAGCAGTGGCAACCCAATGGGGTCCCTTTCCATACTGTGGAAGCTTCGTTCTTTCACTCTTTGCAATAAATCTTGCTATTGCTC"...,
RealStart=@0x7fff28358ae8, RealEnd=@0x7fff28358aec) at pindel.cpp:1600
1600 while (TheInput[PosIndex] == TheInput[End]) {
(gdb) list
1595 unsigned int &RealStart, unsigned int &RealEnd)
1596 {
1597 unsigned int PosIndex = RealStart + g_SpacerBeforeAfter;
1598 unsigned int Start = PosIndex + 1;
1599 unsigned int End = RealEnd + g_SpacerBeforeAfter - 1;
1600 while (TheInput[PosIndex] == TheInput[End]) {
1601 --PosIndex;
1602 --End;
1603 }
1604 RealStart = PosIndex - g_SpacerBeforeAfter;
Any help on this would be appreciated.