Entering edit mode
                    15 months ago
        omicon
        
    
        ▴
    
    40
    Hello everyone,
I am working with different RNA-seq datasets from GEO. The experiments focus on miRNAs, and I downloaded the count tables where I found some rows with the following characteristics:
hsa-miR-520d-5p+miR-527+miR-518a-5p; 11; 7; 21; 100; 58; 0; 900.
hsa-miR-181b-5p+hsa-miR-181d-5p; 1; 30; 50; 600; 8; 0; 0
Is this normal in RNA-seq? I found some information about (two o three miRNAs being sequencing at the same time) "miRNA + miRNA", and it is considered "multiple annotation" or co-detection in the sequencing process. Is it better to clean these this rows?
If you have more information about why this happens and how to handle it, I would greatly appreciate it.
I think it is not common, specially since they dont have the same sequence:
hsa-181d AACAUUCAUUGUUGUCGGUGGGU
hsa-181b AACAUUCAUUGCUGUCGGUGGGU
Similar but not identical, I would just re-download and map it back to the mirBase database.