User: Aishwarya Kulkarni

Reputation:
80
Status:
Trusted
Location:
United States
Last seen:
2 months, 1 week ago
Joined:
6 years, 7 months ago
Email:
s********@gmail.com

about me

Posts by Aishwarya Kulkarni

<prev • 39 results • page 1 of 4 • next >
0
votes
0
answers
97
views
0
answers
Comment: C: .seq extension files
... Thank you so much, this is exactly what I needed. ...
written 12 weeks ago by Aishwarya Kulkarni80
1
vote
0
answers
97
views
0
answers
.seq extension files
... I am dealing with a file called GABPA_GM12878_GABP_HudsonAlpha_AC.seq.gz which is a CLIP seq dataset, the format is as follows: FoldID EventID seq Bound A seq_00001_peak AACCAAGAACACAACTGAAATGGTGCGTCCCGCTGCCAAACACGTCCCCGCCCTCTCTTCCGCTTCCGGCCTGGCGCCTTCCTCCCCCTTTGCGCTCCGGT ...
sequence chip-seq written 12 weeks ago by Aishwarya Kulkarni80 • updated 12 weeks ago by RamRS30k
0
votes
0
answers
100
views
0
answers
Graphprot interpretation for instances of binding sites
... I am using Graphprot to train on a Clip Seq data and test it on certain regions for binding profile of an RBP, I was wondering if any one has run this method and if so if they were able to get instances of the binding sequence obtained from the trained model. ...
graphprot clipseq motif training testing written 3 months ago by Aishwarya Kulkarni80
0
votes
0
answers
365
views
0
answers
Comment: C: Bulk Download all CDS and UTRs of known genes from ENSEMBL
... Yes I just realized that after posting and perusing through the gtf, just want to confirm.Thanks ...
written 16 months ago by Aishwarya Kulkarni80
2
votes
0
answers
365
views
0
answers
Bulk Download all CDS and UTRs of known genes from ENSEMBL
... I want to download all the CDS and UTR coordinates (based on gene id ) from ensembl, is there a way to do that through biomart or biomaRt package? ...
cds utr ensembl written 16 months ago by Aishwarya Kulkarni80 • updated 16 months ago by ATpoint38k
1
vote
1
answer
663
views
1
answer
How to have frequency displayed on the Y axis in weblogo
... I am using weblogo http://weblogo.berkeley.edu/logo.cgi to try and generate weblogos with frequency (upto 100) displayed on Y axis, I assumed checking the box for frequency plot would do it but I get no display on the Y axis How can it be changed to display frequency on Y axis ? ...
weblogo written 2.5 years ago by Aishwarya Kulkarni80 • updated 2.5 years ago by Alex Reynolds30k
0
votes
0
answers
1.6k
views
0
answers
Comment: C: ViennaPackage define output file name and location(RNAplfold)
... Hi @Martombo I am trying to make sense of the results from the -o option and the file looks something like this 1 32 0.0364564 2 30 0.0896707 2 37 0.0202369 2 41 0.135411 3 11 0.0100824 3 29 0.0610271 3 36 0.0134329 3 40 0.0894272 3 54 0.0288916 4 10 0.0104427 4 28 0.0460893 4 ...
written 4.0 years ago by Aishwarya Kulkarni80
2
votes
5
answers
1.3k
views
5
answers
Answer: A: Find transcription factors that bind to inputted nucleotide sequence?
... HOMER is the best tool I have used so far in terms of ease and good documentation , let me know if you need any help with it : http://homer.salk.edu/homer/index.html ...
written 4.0 years ago by Aishwarya Kulkarni80
0
votes
0
answers
973
views
0
answers
Wrapper for RNAplfold
... I am trying to use RNAplfold for target site accessibility of RNA Binding Proteins, has anyone used a good wrapper to use the tool to extract the TAS probability at that binding site. Also what would be the optimum parameters to extract TAS for say for eg a 10 mer binding site? ...
rnaplfold rna-seq bindingsites written 4.0 years ago by Aishwarya Kulkarni80
0
votes
1
answer
2.6k
views
1
answers
Comment: C: Interpretation of RNAplfold
... So does that mean that for the probability of the first 11 mer being unpaired would be under 11 th row and 11 the column i.e at 11-11+1...11? for instance 11 0.6214644 0.5804635 0.5794147 0.5787987 0.5336643 0.512956 0.4683483 0.4437102 0.4185386 0.381642 **0.3854975** The last one will be the ...
written 4.1 years ago by Aishwarya Kulkarni80

Latest awards to Aishwarya Kulkarni

Popular Question 12 weeks ago, created a question with more than 1,000 views. For Conservation score for selected species
Student 15 months ago, asked a question with at least 3 up-votes. For Average PhastCon score for a bed file
Popular Question 18 months ago, created a question with more than 1,000 views. For Conservation score for selected species
Popular Question 18 months ago, created a question with more than 1,000 views. For RNA binding motif
Popular Question 19 months ago, created a question with more than 1,000 views. For Conservation score for selected species
Popular Question 2.5 years ago, created a question with more than 1,000 views. For Conservation score for selected species
Popular Question 2.5 years ago, created a question with more than 1,000 views. For Retrieving RNA sequence from corresponding genomic coordinates
Popular Question 2.5 years ago, created a question with more than 1,000 views. For Tool to calculate extreme most positions in a bed file for a given window
Popular Question 2.5 years ago, created a question with more than 1,000 views. For Average PhastCon score for a bed file
Popular Question 2.5 years ago, created a question with more than 1,000 views. For Conservation score for selected species
Popular Question 3.1 years ago, created a question with more than 1,000 views. For Conservation score for selected species
Popular Question 3.1 years ago, created a question with more than 1,000 views. For Average PhastCon score for a bed file
Popular Question 3.7 years ago, created a question with more than 1,000 views. For RNA binding motif
Popular Question 3.7 years ago, created a question with more than 1,000 views. For Average PhastCon score for a bed file
Supporter 3.8 years ago, voted at least 25 times.
Popular Question 4.4 years ago, created a question with more than 1,000 views. For Average PhastCon score for a bed file

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 686 users visited in the last hour