User: tarakaramji

gravatar for tarakaramji
tarakaramji10
Reputation:
10
Status:
New User
Location:
Last seen:
2 weeks, 1 day ago
Joined:
3 years, 1 month ago
Email:
t**********@gmail.com

about me

Posts by tarakaramji

<prev • 5 results • page 1 of 1 • next >
0
votes
1
answer
127
views
1
answers
Comment: C: Append two fasta sequences
... Thank you..Both works perfect!! ...
written 27 days ago by tarakaramji10
1
vote
1
answer
127
views
1
answers
Comment: C: Append two fasta sequences
... I have tried the EMBOSS tool pasteseq which appends only the first sequence but does not retrieve the identifiers ...
written 27 days ago by tarakaramji10
7
votes
1
answer
127
views
5 follow
1
answer
Append two fasta sequences
... I have two fasta files with different header and sequences and would like to append them one after the other in the same sequential order Input: first file >RNA1 AATGACGATGACGATGACAGAT >RNA2 ATAGATGGGCAGTAGAGA ---------- File2: >mRNA1 ATGGAGATGAGAT >mRN ...
fasta bioperl biopython written 27 days ago by tarakaramji10 • updated 27 days ago by Pierre Lindenbaum92k
0
votes
9
answers
82k
views
9
answers
Comment: C: Gnu Parallel - Parallelize Serial Command Line Programs Without Changing Them
... This is just wonderful. As you have mentioned above GNU Parallel to parallelize you own scripts which can be bash/python/perl etc which can take multiple IDs (i.e, arguments) at a single go. Does it do the other way so? which taking a single argument and run it in multiple cores of the computer??? ...
written 3.1 years ago by tarakaramji10
1
vote
1
answer
1.1k
views
1
answer
Remove Motif Sequence From The Fasta File Of Sequences
... Dear colleagues! I have a file with sequences in FASTA format. I want to remove part of sequence with known coordinates from the fasta file. In detail, i have a file1 with sequence ID with coordinates and file 2 has the fasta sequences of all that were mentioned in the file1. taking this coordinat ...
fasta perl bioperl written 3.1 years ago by tarakaramji10 • updated 3.1 years ago by swbarnes22.7k

Latest awards to tarakaramji

Popular Question 3.1 years ago, created a question with more than 1,000 views. For Remove Motif Sequence From The Fasta File Of Sequences

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 935 users visited in the last hour