User: tarakaramji

gravatar for tarakaramji
New User
Last seen:
9 months, 2 weeks ago
4 years, 3 months ago

about me

Posts by tarakaramji

<prev • 5 results • page 1 of 1 • next >
Comment: C: Append two fasta sequences
... Thank you..Both works perfect!! ...
written 14 months ago by tarakaramji10
Comment: C: Append two fasta sequences
... I have tried the EMBOSS tool pasteseq which appends only the first sequence but does not retrieve the identifiers ...
written 14 months ago by tarakaramji10
5 follow
Append two fasta sequences
... I have two fasta files with different header and sequences and would like to append them one after the other in the same sequential order Input: first file >RNA1 AATGACGATGACGATGACAGAT >RNA2 ATAGATGGGCAGTAGAGA ---------- File2: >mRNA1 ATGGAGATGAGAT >mRN ...
fasta bioperl biopython written 14 months ago by tarakaramji10 • updated 14 months ago by Pierre Lindenbaum108k
Comment: C: Gnu Parallel - Parallelize Serial Command Line Programs Without Changing Them
... This is just wonderful. As you have mentioned above GNU Parallel to parallelize you own scripts which can be bash/python/perl etc which can take multiple IDs (i.e, arguments) at a single go. Does it do the other way so? which taking a single argument and run it in multiple cores of the computer??? ...
written 4.2 years ago by tarakaramji10
Remove Motif Sequence From The Fasta File Of Sequences
... Dear colleagues! I have a file with sequences in FASTA format. I want to remove part of sequence with known coordinates from the fasta file. In detail, i have a file1 with sequence ID with coordinates and file 2 has the fasta sequences of all that were mentioned in the file1. taking this coordinat ...
fasta perl bioperl written 4.3 years ago by tarakaramji10 • updated 4.3 years ago by swbarnes23.6k

Latest awards to tarakaramji

Popular Question 4.2 years ago, created a question with more than 1,000 views. For Remove Motif Sequence From The Fasta File Of Sequences


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1095 users visited in the last hour