User: auroramaurizio1

Reputation:
20
Status:
New User
Location:
European Union
Last seen:
4 years, 9 months ago
Joined:
5 years, 5 months ago
Email:
a**************@gmail.com

about me

Posts by auroramaurizio1

<prev • 11 results • page 1 of 2 • next >
2
votes
1
answer
3.8k
views
1
answer
PacBio Long Read error correction through PBcR --> pacbio.spec field
... Hello, I'm trying to self-correct PacBio long fastq sequences using Celera 8.2 assembler through the  PBcR pipeline (http://wgs-assembler.sourceforge.net/wiki/index.php/PBcR). Since the pacbio.spec option is mandatory, can anybody explain me how a correct minimal pacbio.spec file should be built? ...
errorcorrection celera pacbio longreads written 4.9 years ago by auroramaurizio120 • updated 4.8 years ago by geek_y9.8k
0
votes
0
answers
2.8k
views
0
answers
Comment: C: BWA_MEM on PacBio Reads
... Found it!! Thank you for your time!! ...
written 5.0 years ago by auroramaurizio120
0
votes
0
answers
2.8k
views
0
answers
Comment: C: BWA_MEM on PacBio Reads
... Thank you, this is exactly what I was looking for! Is it explained in the manual? May you give me some references? ...
written 5.0 years ago by auroramaurizio120
0
votes
0
answers
2.8k
views
0
answers
Comment: A: BWA_MEM on PacBio Reads
... Is it possible to cancel a post? Can you teach me how? Thanks! ...
written 5.0 years ago by auroramaurizio120
0
votes
0
answers
2.8k
views
0
answers
Comment: C: BWA_MEM on PacBio Reads
... Thank you Devon Ryan for the reply, i'll delete the one in SeqAnswers :). Do you work with these tools? I would greatly appreciate it if you kindly give me some feedback! I wanted to know how the -x pacbio option works ... originally BWA-mem was not designed with Pac-Bio in mind. I wanted also to n ...
written 5.0 years ago by auroramaurizio120
2
votes
0
answers
2.8k
views
0
answers
BWA_MEM on PacBio Reads
... Hello, can anybody explain me please how does the BWA-mem -x pacbio (Release 0.7.10, default settings ) algorithm work? I found this interesting blog   http://www.homolog.us/blogs/blog/2014/04/07/bwa-mem-vs-blasr-for-pacbio-need-help-with-benchmarking/  but it is still not clear to me. Can you als ...
bwa-mem pacbio written 5.0 years ago by auroramaurizio120
0
votes
1
answer
3.5k
views
1
answers
Comment: C: How To Calculate Overlap Read Lengths
... R1 @M01598:61:000000000-A723A:1:1101:21164:1373 1:N:0:1 CTGGCTGAATGAGACTGGTGTCGACACTAGTGGTACTGATGAAGTTCAGAGGAGCCAAGATGGCCGAATAGGAACAGCTCCGGTCTACAGTTCCCAGCCCGAGCGACGCAGAAGACTGGTGATTTCTGCATTTCCATCTGAGGTACTGGCTTCATCTCACTACGTAGTGCCAGACAGTGGGCGCACTCCAGTGGGTGCGCGCACCGGGCACGAGCAGAAGCAGGGCAAGGCATTGCCTCACCT ...
written 5.4 years ago by auroramaurizio120
0
votes
1
answer
3.5k
views
1
answers
Comment: C: How To Calculate Overlap Read Lengths
... You are so rigth. This is the reason why I was thinking about doing something like length of read1 + length of read 2 - length of assembled read 1/2. So if R1 A G T G C A C T A G T G G T length is 14 and R2 C A C T A G T G G T A T A A length is 14 and their sum is 14+14= 28 while Pear R1/R2 A G T G ...
written 5.4 years ago by auroramaurizio120
0
votes
1
answer
3.5k
views
1
answers
Comment: C: How To Calculate Overlap Read Lengths
... Thank you! this very useful but I think I wasn't clear about what I was asking. I would like to know if Pear respected the parameters i gave it (min overlap length= 50 etc..) inspecting the length of the overlap region contained in every merged read contained in pear_R1R2.assembled.fastq file. Sorr ...
written 5.4 years ago by auroramaurizio120
0
votes
1
answer
3.5k
views
1
answers
Comment: C: How To Calculate Overlap Read Lengths
... I have 3 files in fastq format. R1.fastq, R2.fastq, pear_R1R2.assembled.fastq. This is an example of what I am talking about. I show only the sequence (2nd line in the fastq file) R1 A G T G C A C T A G T G G T R2 C A C T A G T G G T A ...
written 5.4 years ago by auroramaurizio120

Latest awards to auroramaurizio1

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 780 users visited in the last hour