User: kaaschr

gravatar for kaaschr
kaaschr10
Reputation:
10
Status:
New User
Location:
Denmark
Last seen:
4 years, 9 months ago
Joined:
5 years, 8 months ago
Email:
k******@gmail.com

about me

Posts by kaaschr

<prev • 5 results • page 1 of 1 • next >
0
votes
0
answers
3.0k
views
0
answers
Comment: A: blast+ with a degenerate nucleotide
... My goal is to find in the 2.5Gbp genome where CTTTCTGAAGTCCNGG can align with 0,1 or 2 mismatches. But would you not say that blastn is the most user-friendly string-comparaison tool out there? Just to clarify: I am just pretty new to bioinformatics, so the solution is probably very straight forwa ...
written 4.8 years ago by kaaschr10
1
vote
0
answers
3.0k
views
0
answers
blast+ with a degenerate nucleotide
... I would like to find the places in the genome were my Crispr guide RNA might cause off-target cleavage. example target: AGGGGTCCTTTCTGAAGTCCAGG It usually bind to sequences that are identical with the 13 bp upstream of the PAM = NNNNNNNCTTTCTGAAGTCCNGG so i would like to do a search with blast+ (i ...
alignment blast written 4.8 years ago by kaaschr10 • updated 4.4 years ago by Biostar ♦♦ 20
0
votes
1
answer
5.2k
views
1
answers
Comment: C: Bootstrapping => consensus tree construction based on distance matrices
... Dear David Thank your that that little comment. that made all the difference. Now the (B=1) is similar to the one from the entire dataset and B=100 is slight different. My dataset had no changes at all after B=1000 so it must be pretty stable. Thanks a lot for your help. Have a nice day ...
written 5.4 years ago by kaaschr10
0
votes
1
answer
5.2k
views
1
answers
Comment: C: Bootstrapping => consensus tree construction based on distance matrices
... Hi David thank you for answering my question. The method works... but the resulting concensus tree loose most of the information seen in the original tree. If we use your example and run your code and follow it with bs <- boot.phylo(point_est, cn_matrix, estimate_tr, trees=TRUE, B=1)   bs2 < ...
written 5.4 years ago by kaaschr10
0
votes
1
answer
5.2k
views
1
answer
Bootstrapping => consensus tree construction based on distance matrices
... For my PhD project i am trying to use copy number variations (CNVs) to deduce phylogeny between 9 cancer cell lines... and it seem to work quite well. It is not hard to  get to a 9x9 distance matrix showing the copy number variations between each of them (400-2000 CNVs out of 20000 genes in the geno ...
R phylogenetics bootstrap ape written 5.4 years ago by kaaschr10 • updated 5.4 years ago by David W4.7k

Latest awards to kaaschr

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1164 users visited in the last hour