User: hmg

gravatar for hmg
hmg20
Reputation:
20
Status:
New User
Location:
Canada
Last seen:
9 months ago
Joined:
4 years, 6 months ago
Email:
h*************@gmail.com

about me

Posts by hmg

<prev • 15 results • page 1 of 2 • next >
0
votes
0
answers
526
views
0
answers
Comment: C: How to initialize silent states for pair HMM forward algorithm?
... No I understand that. When you calculate the cell, it's F(s, p) = e_s(S_p) * Sum [ a_k(s) * F(k, p-1) ] for real states F(s, p) = Sum [ a_k(s) * F(k, p) ] for silent states, correct? Where s=state, p=position, e_s=emission probability of state s, S_p=symbol at posit ...
written 9 months ago by hmg20
0
votes
0
answers
526
views
0
answers
Comment: C: How to initialize silent states for pair HMM forward algorithm?
... Ok, working with an example output sequence of: AAC TAC Which can also be considered `mismatch match match (m M M)`. I set up my table: . 0 1:m 2:M 3:M B 1 0 0 0 RX1 0 S1 0 RY1 0 S2 0 M 0 X 0 Y 0 S3 0 RX2 0 ...
written 9 months ago by hmg20
0
votes
0
answers
526
views
0
answers
Comment: C: How to initialize silent states for pair HMM forward algorithm?
... That was my understanding, and that's how I've coded my silent states. I've added more info to my question to hopefully show this. I imagine I am initializing the forward algorithm incorrectly then, because the f scores remain at 0 and the sum probability is 0. How do you initialize when dealing wit ...
written 9 months ago by hmg20
0
votes
0
answers
526
views
0
answers
Comment: C: How to initialize silent states for pair HMM forward algorithm?
... Sorry, I'm wondering how to implement the forward algorithm in the local alignment pair HMM described by Durbin et al, which includes four silent states. The book excplicitly describes the forward algorithm for the global alignment pair HMM, but not how to make changes to include the silent states a ...
written 9 months ago by hmg20
0
votes
0
answers
526
views
0
answers
How to initialize silent states for pair HMM forward algorithm?
... I'm writing code for a pair HMM based on the information provided in Durbin et al's Biological Sequence Analysis (10th reprint). I understand the global alignment model described in chapter 4, but am having some trouble with the local alignment model. Specifically, I'm not sure how to initialize the ...
alignment pairhmm written 9 months ago by hmg20
0
votes
1
answer
3.0k
views
1
answers
Comment: C: Extracting subsequence from FASTA using Samtools faidx not working
... Yep--I didn't index it at all. Silly error by me. Thanks for the help. ...
written 2.7 years ago by hmg20
0
votes
1
answer
3.0k
views
1
answers
Comment: C: Extracting subsequence from FASTA using Samtools faidx not working
... Just: ​>first_seq ...
written 2.7 years ago by hmg20
0
votes
1
answer
3.0k
views
1
answers
Comment: C: Extracting subsequence from FASTA using Samtools faidx not working
... I tried that, but no luck: >first_seq AGCATGCATCGTACGATCGTACGATCATCATC GTACGATCGATCGATCGATCGATCGTGTGCTA GACGATCGATCGATCGA >second_seq GTACGATGCATCGATCGATCGATCGATCGATC GTGATCGTGTCGTCGTCGTCGATAAGCATCGT AGTACGATCGATCGTA   samtools faidx seq4.fa first_seq:1-5 >first_seq:1-5 ...
written 2.7 years ago by hmg20
5
votes
1
answer
3.0k
views
1
answer
Extracting subsequence from FASTA using Samtools faidx not working
... Hello, I have a FASTA file, and I want to extract a subsequence from it.  >first AGCATGCATCGTACGATCGTACGATCATCATC GTACGATCGATCGATCGATCGATCGTGTGCTA GACGATCGATCGATCGA >second GTACGATGCATCGATCGATCGATCGATCGATC GTGATCGTGTCGTCGTCGTCGATAAGCATCGT AGTACGATCGATCGTA   I know I can do this wit ...
fasta faidx samtools written 2.7 years ago by hmg20
0
votes
3
answers
13k
views
3
answers
Comment: C: Get Fasta File With Protein Sequences Given Entrez Gene Ids
... Hello, I'm looking at your answer two years later and am wondering if I could get some help with your updated code (for finding protein IDs as opposed to protein FASTA sequences). I tried the code as typed, but I get the following output: sort: multi-character tab `    ' sort: multi-character tab ...
written 3.4 years ago by hmg20

Latest awards to hmg


Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1287 users visited in the last hour