User: zorbax

gravatar for zorbax
zorbax40
Reputation:
40
Status:
New User
Location:
Mexico
Last seen:
1 day, 13 hours ago
Joined:
5 years, 11 months ago
Email:
o*****@gmail.com

Posts by zorbax

<prev • 13 results • page 1 of 2 • next >
0
votes
1
answer
72
views
1
answers
Answer: A: Clump gene entries for metagenomic data/ humann2
... If you have the `'Protein names'` and `'Organism'` columns in one table you can use Pandas. df.groupby('Protein names')['Organism'].agg(lambda col: ','.join(col)).reset_index() For this table: class order bird Falconiformes bird Psittaciformes mammal Carnivora mammal Prima ...
written 4 weeks ago by zorbax40
0
votes
0
answers
118
views
0
answers
Comment: C: Problem in QIIME: Cannot run OTU picking script.
... First of all qiime 1.9 it's an outdated version and it's legacy code. But if you want to analize you data with qiime 1.9 using the open approach you need the `-r` option with the path to the greengenes/silva fasta file, otherwise you will get an error. And if you want also, you need to define the ...
written 4 weeks ago by zorbax40
0
votes
1
answer
77
views
1
answers
Comment: C: Biopython PairwiseAligner sorting on scores
... `Align.PairwiseAligner()` implements the Needleman-Wunsch, Smith-Waterman, Gotoh, and Waterman-Smith-Beyer global and local pairwise alignment algorithms to find the best-scoring between two sequences. The PairwiseAligner object automatically chooses the appropriate alignment algorithm. You can try ...
written 4 weeks ago by zorbax40
0
votes
1
answer
77
views
1
answers
Answer: A: Biopython PairwiseAligner sorting on scores
... There is only one score value per alignment with `Align.PairwiseAligner()` in this example. from Bio import Align aligner = Align.PairwiseAligner() s = 'ATGGTCGGCTAGCTGGATGCGTA' t = 'AGTCATCGGCTAGTCTGGATGCCCA' score = aligner.score(s, t) alignments = aligner.align(s, t) ...
written 4 weeks ago by zorbax40
1
vote
2
answers
72
views
2
answers
Answer: A: Could I use a BAM file output to make a alignment with others FASTA references?
... You can get the mapped/unmapped reads with the flags, check [this post][1]. Then you can convert the bam file to fastq/fasta with bedtools [bamToFastq][2] [1]: https://www.biostars.org/p/56246/ [2]: https://bedtools.readthedocs.io/en/latest/content/tools/bamtofastq.html ...
written 4 weeks ago by zorbax40
0
votes
1
answer
2.0k
views
1
answers
Answer: A: Fastx toolkits: fastq_quality_filter does not discart any read
... Is just -Q33 without space. ...
written 4.3 years ago by zorbax40
0
votes
1
answer
3.0k
views
1
answers
Answer: A: warning in rstudio
... It's an issue with the directory in which you store you packages, I have come across this 3 solutions if your problem don't solve re-installing "seqinr": 1.  Delete your .Rhistory and .RData files in the directory in which you are running R. 2.  Try to run an "update.packages()" 3.  If those fail, ...
written 4.6 years ago by zorbax40
0
votes
1
answer
1.4k
views
1
answers
Answer: A: extract predicted gene sequences from gilmmer output
... You can use http://dawgpaws.sourceforge.net/man/cnv_genemark2gff.html (this is for GeneMark) For glimmer: grep ^orf output.glimmer | awk '{OFS="\t"}{strang = "+"}{if($4 < 0) strang="-"}{gsub(/[+-]/," ")}{print "FASTA_HEADER", "GLIMMER", "gene" , $2 , $3, $5, strang , $4, "ID="$1"; NOTE:GLIMMER ...
written 4.6 years ago by zorbax40
0
votes
1
answer
978
views
1
answers
Answer: A: Counting Features metaRNA-seq
... Have you tried this? -_- ...
written 5.4 years ago by zorbax40
1
vote
5
answers
3.7k
views
5
answers
Answer: A: RNA probe ids from affymetrix
... cat file_table | awk '{print $1}' | perl -pe 's/\"//g; s/\_at//; s/^\s+//g' | tail -n +2 > ids   Then upload the file here and download the info.   ...
written 5.4 years ago by zorbax40

Latest awards to zorbax

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1082 users visited in the last hour