User: Parimala Devi

gravatar for Parimala Devi
Finland/Tampere/Genevia Technologies
Last seen:
4 days, 13 hours ago
6 years, 4 months ago

Posts by Parimala Devi

<prev • 25 results • page 1 of 3 • next >
How to compute topological coefficients of the gene modules in iPANDA
... I am using iPANDA( [In silico Pathway Activation Network Decomposition Analysis][1]) for calculation of pathway activation score. How are the topological coefficients of the gene modules added to a pathway computed? [1]: ...
ipanda pathway activation score written 22 months ago by Parimala Devi70
Comment: C: VCF file with AF(allele frequency)
... Thank you for the reply. I'm looking for the Allele frequency AF in the INFO. I have 2 vcf files. I need to plot a graph comparing the AF at each position for each chromosome using the 2 vcf files. I used the following command from vcftools. ``` ./vcftools --vcf input_data.vcf --freq --out output ...
written 5.3 years ago by Parimala Devi70 • updated 10 months ago by RamRS30k
VCF file with AF(allele frequency)
... Hi, I need to analyse SNPs based on Allele frequency(AF) and not the AF1. The vcf file I obtained by using samtools excludes the INFO for AC.  ##FORMAT=<ID=DV,Number=1,Type=Integer,Description="# high-quality non-reference bases"> ##FORMAT=<ID=SP,Number=1,Type=Integer,Description="Phred- ...
vcf allele frequency samtools snp written 5.3 years ago by Parimala Devi70 • updated 3.5 years ago by gsr9999120
How to obtain chromosome number from given scaffold number
... Hi, I am working on Saccharomyces cerevisiae, Y55 strain.  I obtained my reference sequence from here.  And this is how the Y55_Stanford_2014_JRIF00000000.fsa sequence looks.  It doesn't include the chromosome number.  Reference >gi|696435221|gb|JRIF01000001.1| Saccharomyces cerevisiae Y55 scaf ...
reference genome scaffold snp chromosome number written 5.3 years ago by Parimala Devi70 • updated 5.3 years ago by Steven Lakin1.5k
Comment: C: How to extract Homozygote variants froma VCF format?
... I tried this, but I did find "0/1" still present in the vcf. ...
written 6.3 years ago by Parimala Devi70
How to extract Homozygote variants froma VCF format?
... I am doing SNP analysis on whole genome saccharomyces cerevisiae. I want to segregate the homozygote variants from the heterozygote variants. How do I go about it? ...
homozygotes snp written 6.3 years ago by Parimala Devi70 • updated 6.3 years ago by Yahan390
Comment: C: RNA-SeQC error no output
... This is the output: head Saccer3_genome.fa ~/SPRING-SUMMER_2014/RNA-seq/RNA-seq_C1W8_time_work_bench/Sac_cerevisiae.gtf ==> Saccer3_genome.fa <== >chrI CCACACCACACCCACACACCCACACACCACACCACACACCACACCACACC CACACACACACATCCTAACACTACCCTAACACAGCCCTAATCTAACCCTG GCCAACC ...
written 6.3 years ago by Parimala Devi70 • updated 8 months ago by RamRS30k
Comment: C: RNA-SeQC error no output
... They're numbered in roman numerals. ...
written 6.3 years ago by Parimala Devi70
8 follow
RNA-SeQC error no output
... I am running RNA-SeQC on RNA-seq data. The following is the command. Command : java -jar ~/SPRING-SUMMER_2014/Softwares/RNA-SeQC_v1.1.7.jar -r Saccer3_genome.fa -o ~/SPRING-SUMMER_2014/RNA-seq/RNA-seq_C1W8_time_work_bench/ -s C1W8_8hr_PE_output_soap_BAM_sorted.bam -t ~/SPRING-SUMMER_2014/RNA-seq/R ...
quality control tool rna-seq written 6.3 years ago by Parimala Devi70 • updated 3.1 years ago by Isaac C. Joseph 80
Comment: C: IGV can't view SAM file
... I converted the file to BAM, sorted and indexed it all using samtools,again. Also, the IGV is in it's latest version v.2.0.30-1. I'm still getting the same error. ...
written 6.3 years ago by Parimala Devi70 • updated 8 months ago by RamRS30k

Latest awards to Parimala Devi

Great Question 12 months ago, created a question with more than 5,000 views. For How to compare 2 VCF files
Supporter 12 months ago, voted at least 25 times.
Epic Question 12 months ago, created a question with more than 10,000 views. For How to compare 2 VCF files
Great Question 18 months ago, created a question with more than 5,000 views. For How to compare 2 VCF files
Student 20 months ago, asked a question with at least 3 up-votes. For How to compare 2 VCF files
Popular Question 20 months ago, created a question with more than 1,000 views. For How to obtain chromosome number from given scaffold number
Great Question 2.6 years ago, created a question with more than 5,000 views. For vcftools: SNP filtering
Popular Question 2.7 years ago, created a question with more than 1,000 views. For How to obtain chromosome number from given scaffold number
Great Question 3.6 years ago, created a question with more than 5,000 views. For How to compare 2 VCF files
Epic Question 3.6 years ago, created a question with more than 10,000 views. For How to compare 2 VCF files
Popular Question 4.3 years ago, created a question with more than 1,000 views. For How to compare 2 VCF files
Great Question 4.5 years ago, created a question with more than 5,000 views. For How to compare 2 VCF files
Popular Question 4.5 years ago, created a question with more than 1,000 views. For How to compare 2 VCF files
Popular Question 4.8 years ago, created a question with more than 1,000 views. For IGV can't view SAM file
Popular Question 5.1 years ago, created a question with more than 1,000 views. For vcftools: SNP filtering
Popular Question 5.3 years ago, created a question with more than 1,000 views. For vcftools: SNP filtering
Popular Question 5.5 years ago, created a question with more than 1,000 views. For How to compare 2 VCF files
Popular Question 5.5 years ago, created a question with more than 1,000 views. For How to compare 2 VCF files


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1571 users visited in the last hour