User: Veli Kaan Aydin

Reputation:
40
Status:
New User
Location:
Turkey
Last seen:
11 months, 2 weeks ago
Joined:
5 years, 11 months ago
Email:
v**********@gmail.com

Undergraduate student at Bioengineering dep. in Ege University in Turkey. 

Posts by Veli Kaan Aydin

<prev • 27 results • page 1 of 3 • next >
0
votes
1
answer
1.4k
views
1
answers
Comment: C: Analysing with cummeRbund finding extreme genes.
... I did not understand these gene result is from GenBank and it look meaningless to me and I need to find which genes are different and what are their functions so I use bioDBnet and It really confuse my head because it did not find any conversion until I delete the part after dot and when it gave me ...
written 5.9 years ago by Veli Kaan Aydin40
0
votes
1
answer
1.4k
views
1
answers
Comment: C: Analysing with cummeRbund finding extreme genes.
... I figure out which ones I need, but I am trying to find what is its name and funtion. Here it is a line; How can I find it ? test_id gene_id gene locus sample_1 sample_2 status value_1 value_2 log2(fold_change) test_stat p_value q_value significant ...
written 5.9 years ago by Veli Kaan Aydin40
0
votes
1
answer
1.4k
views
1
answer
Analysing with cummeRbund finding extreme genes.
... First thanks all guys you showed up when I need help and I need to do one more thing. On the figure below I need to find names of extreme different genes or all if posibble(I circle some of them). Or there is a better thing for me if I can show all names on figure. Doesn anyone know how to do that? ...
cummerbund rna-seq written 5.9 years ago by Veli Kaan Aydin40 • updated 5.9 years ago by Chris Evelo10k
0
votes
0
answers
4.6k
views
0
answers
Comment: C: Tophat qual length error.
... Ok I just tried again and again I guess it works now ; because it still writing like this; [2014-08-26 22:12:31] Retrieving sequences for splices (for nearly 14 hours)   ...
written 5.9 years ago by Veli Kaan Aydin40
0
votes
0
answers
4.6k
views
0
answers
Comment: C: Tophat qual length error.
... By the way I just started with first run which means SRR408751 @HWI-EAS19:2:26:1681:1147 TTCGACTCTGCCGTTCCTTGCGCACCACCTCCTCCTCCTCCTGCGCTTC +HWI-EAS19:2:26:1681:1147 B4=55=;9/;3955/3/533431&8;355523535############### @HWI-EAS19:2:26:1681:1153 CGATTACAGAACAGGCTCCTCTAGAGGGGTATGAAGCACCGCCAGGTCCT a ...
written 5.9 years ago by Veli Kaan Aydin40
0
votes
0
answers
4.6k
views
0
answers
Comment: C: Tophat qual length error.
... Thank you for your answer but I'm still getting this; Error: qual length (50) differs from seq length (43) for fastq record HWI-EAS19:2:26:1681:1147! ...
written 5.9 years ago by Veli Kaan Aydin40
0
votes
0
answers
4.6k
views
0
answers
Comment: C: Tophat qual length error.
... I find and change a script ;  from tempfile import mkstemp from shutil import move from os import remove, close def replace(file_path):     fh, abs_path = mkstemp()     new_file = open(abs_path,'w')     old_file = open(file_path)     for line in old_file:         if line[0] == "+":             ne ...
written 5.9 years ago by Veli Kaan Aydin40
0
votes
0
answers
4.6k
views
0
answers
Comment: C: Tophat qual length error.
... When I got fastq-dump it was like this: @SRR408754.1 HWI-EAS19:6:1:2:223 length=50 GCAAACCAGAGCTCAGAAAAAAGGGACATCCAGCAGTGGTCATTCGGCAA +SRR408754.1 HWI-EAS19:6:1:2:223 length=50 BB<ACCBA@9@@@@=@==<.872='==>==9-:################# @SRR408754.2 HWI-EAS19:6:1:3:199 length=50 AAAAACTGGACATTTGCAG ...
written 5.9 years ago by Veli Kaan Aydin40
0
votes
0
answers
4.6k
views
0
answers
Tophat qual length error.
... Hello everyone;   I'm trying to rna-seq analysis for Illumina Genome Analyzer (Homo sapiens) and here fastq file ;  @SRR408754.1 HWI-EAS19:6:1:2:223 length=50 GCAAACCAGAGCTCAGAAAAAAGGGACATCCAGCAGTGGTCATTCGGCAA + BB<ACCBA@9@@@@=@==<.872='==>==9-:################# @SRR408754.2 HWI-EAS1 ...
tophat rna-seq written 5.9 years ago by Veli Kaan Aydin40
0
votes
0
answers
1.5k
views
0
answers
Comment: C: Runnig tuxedo with SOLID data (color_space_index)
... Ok I understand that,  thank you :) ...
written 5.9 years ago by Veli Kaan Aydin40

Latest awards to Veli Kaan Aydin

Great Question 5.9 years ago, created a question with more than 5,000 views. For How to convert to .SRA files to .FQ (FASTQ)
Epic Question 5.9 years ago, created a question with more than 10,000 views. For How to convert to .SRA files to .FQ (FASTQ)
Popular Question 5.9 years ago, created a question with more than 1,000 views. For Tophat qual length error.
Popular Question 5.9 years ago, created a question with more than 1,000 views. For How to convert to .SRA files to .FQ (FASTQ)
Popular Question 5.9 years ago, created a question with more than 1,000 views. For Analysing with cummeRbund finding extreme genes.
Popular Question 5.9 years ago, created a question with more than 1,000 views. For Error running 'prep_reads' on TopHat (v2.0.9)
Popular Question 5.9 years ago, created a question with more than 1,000 views. For Runnig tuxedo with SOLID data (color_space_index)
Student 5.9 years ago, asked a question with at least 3 up-votes. For How to convert to .SRA files to .FQ (FASTQ)
Autobiographer 5.9 years ago, has more than 80 characters in the information field of the user's profile.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1323 users visited in the last hour