User: chrisclarkson100

Reputation:
50
Status:
Trusted
Location:
European Union
Last seen:
2 days, 16 hours ago
Joined:
3 years ago
Email:
c***************@yahoo.co.uk

Posts by chrisclarkson100

<prev • 83 results • page 1 of 9 • next >
0
votes
1
answer
119
views
1
answer
PFM for CTCF in mm9 extremely difficult to find- or does one exist?
... Apologies for the naive question but I am new to the field of Position Frequency matrices (PFMs). I am trying to find a PFM for CTCF binding in the mm9 version of the mouse genome... I have searched JASPAR, TRANSFAC and http://ccg.vital-it.ch/pwmtools/pwmbrowse.html. None of the databases in these ...
assembly written 4 weeks ago by chrisclarkson10050 • updated 4 weeks ago by jared.andrews07140
0
votes
2
answers
198
views
2
answers
Comment: C: separating bed file into separate files for every 100000 base pairs
... Hi, thank you for this, In your GitHub example you input: first_fit.py hg19.gapped_extents.bed 100 1e8 I have tried your example on my own data and it looks encouraging but I am looking to write the lines within a certain base pair range to separate files. This script does not seem to do that. The ...
written 4 weeks ago by chrisclarkson10050
5
votes
2
answers
198
views
2
answers
separating bed file into separate files for every 100000 base pairs
... I have a really large bed file (24 GB) and I want to separate it into different files for every million base pairs. I have done it the pure programming way but this really slow #python file=open(sys.argv[1], 'r') lines=file.readlines() #print lines start=[] end=[] chr=[] ...
assembly written 4 weeks ago by chrisclarkson10050
6
votes
2
answers
172
views
2
answers
gc content file for human genome large and difficult to parse into separate chromosome files
... I have just downloaded the following 'gc content' documenting file: http://hgdownload.cse.ucsc.edu/goldenPath/hg19/hg19.gc5Base.txt.gz The file contains data for all chromosomes in hg19. **it is not in bed format which makes it difficult to parse in terms of separating into chromosome files ** ...
assembly written 4 weeks ago by chrisclarkson10050 • updated 4 weeks ago by igor4.6k
0
votes
1
answer
237
views
1
answers
Comment: C: sam2bed processing paired-end data and producing unexpectedly short intervals in
... I don't actually have this file in BAM format... I mapped it directly to sam format with: bowtie2 -x mm9 --very-sensitive -p 8 -1 SRR1.fastq -2 SRR2.fastq -S out.sam so the only file here is in sam format ...
written 6 weeks ago by chrisclarkson10050
0
votes
1
answer
237
views
1
answers
Comment: C: sam2bed processing paired-end data and producing unexpectedly short intervals in
... I should also mention that I have previously used a script to account for the paired end read data: https://github.com/homeveg/nuctools/extend_PE_reads.pl but this did not seem to make a difference to the intervals, the vast majority of which are < 147. Hence I was worried that it might be a ste ...
written 6 weeks ago by chrisclarkson10050
0
votes
1
answer
237
views
1
answers
Comment: C: sam2bed processing paired-end data and producing unexpectedly short intervals in
... for me `samtools view Ishii.sam | head -n 10` returns SRR1781827.7 99 chr13 88806847 1 50M = 88806979 182 AGTTCCTTTGTGAATGTGTTACCTCACTCAGGATGATGCCCTCCAGGTCC BCCFDFFFHGHHFHIJIJJJIJJIJGJJJIIIHIJHIJJJJIJJIJIJJJ AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:50 YS:i:0 YT:Z:CP SRR1781827 ...
written 6 weeks ago by chrisclarkson10050
0
votes
1
answer
237
views
1
answers
Comment: C: sam2bed processing paired-end data and producing unexpectedly short intervals in
... My job is to document the position of each nucleosome in the genome- using various datasets from MNAse experiments. My job will then be to calculate the nucleosome repeat length (NRL) in different regions. I have a script that does this by analysing the consecutive distances between the starts of ea ...
written 6 weeks ago by chrisclarkson10050
0
votes
1
answer
237
views
1
answers
Comment: C: sam2bed processing paired-end data and producing unexpectedly short intervals in
... Hi, I tried this on my own data and it gave a very strange output that was not in bed format: samtools sort -n -l 0 -O bam Ishii.sam | bedtools bamtobed -i - -bedpe | cut -f1,2,6,7,8,9 | sort -k1,1 -k2,2n > sorted_new.bed . -1 100000009 SRR1781827.163167397 0 ...
written 6 weeks ago by chrisclarkson10050
0
votes
1
answer
237
views
1
answers
Comment: C: sam2bed processing paired-end data and producing unexpectedly short intervals in
... Hi, I should have replied to your answer I will do so now in a comment on your answer below ...
written 6 weeks ago by chrisclarkson10050

Latest awards to chrisclarkson100

Supporter 4 weeks ago, voted at least 25 times.
Popular Question 10 weeks ago, created a question with more than 1,000 views. For blastn linux command specify database
Popular Question 3 months ago, created a question with more than 1,000 views. For blastn linux command specify database
Great Question 7 months ago, created a question with more than 5,000 views. For what are single copy genes?
Popular Question 7 months ago, created a question with more than 1,000 views. For sequence BLASTed against itself.... why?
Great Question 7 months ago, created a question with more than 5,000 views. For venn diagram for gene lists using R
Popular Question 7 months ago, created a question with more than 1,000 views. For what are single copy genes?
Popular Question 16 months ago, created a question with more than 1,000 views. For what are single copy genes?
Popular Question 23 months ago, created a question with more than 1,000 views. For what are single copy genes?
Popular Question 2.8 years ago, created a question with more than 1,000 views. For venn diagram for gene lists using R
Student 2.8 years ago, asked a question with at least 3 up-votes. For venn diagram for gene lists using R

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1362 users visited in the last hour