User: m.koohi.m

gravatar for m.koohi.m
m.koohi.m70
Reputation:
70
Status:
Trusted
Location:
United States
Last seen:
5 months, 1 week ago
Joined:
3 years, 7 months ago
Email:
m********@gmail.com

Posts by m.koohi.m

<prev • 33 results • page 1 of 4 • next >
0
votes
0
answers
255
views
0
answers
How can run cd-hit-est with a clstr threshold less than 0.8?
... Dear friends, I try to run cd-hit-est with a cluster threshold less than 0.8 but every time I get the following error: > Fatal Error: invalid clstr threshold, should >=0.8 Program halted !! I tried: cd-hit-est -i seq.fasta -o out.fasta -d 0 -T 10 -g 1 -M 10000 -c 0.6 -n 4 This comman ...
cluster tools cd-hit written 5 months ago by m.koohi.m70
0
votes
0
answers
332
views
0
answers
Is there any REST API for the tree view result of the NCBI Blast?
... Hi there, Using Biopython API I can blast my query seq against NCBI database and get the result same as bellow: from Bio.Blast import NCBIWWW result_handle = NCBIWWW.qblast("blastn", "nt", 'gagtctcctttggaactctgcaggttctatttgctttttcccagatgagctctttttctggtgtttgtct') Now I need the tree view o ...
ncbi python biopython blast written 8 months ago by m.koohi.m70
7
votes
1
answer
951
views
1
answer
What "chrUn" stand for in UCSC genome browser web server?
... In UCSC genome browser web server there are some chromosome which start with "chrUn", for example chrUn_KI270438v1. What are these chromosome exactly? It means Unknown chromosome? If yes, why unknown? ...
genome gene ucsc written 11 months ago by m.koohi.m70 • updated 11 months ago by James Ashmore2.5k
1
vote
1
answer
374
views
1
answer
Does anyone have a cheatsheet to compare Usearch and Bowtie2 performance in different situation?
... I am wondering if anyone has a cheat sheet or paper that compare Usearch and Bowtie2 performance? I really like to know which one is more robust in different situation. For example I want to search short reads against a database of some contigs with length 150-400. Do you have any suggestion which o ...
usearch bowtie2 next-gen alignment written 11 months ago by m.koohi.m70 • updated 11 months ago by h.mon16k
0
votes
0
answers
606
views
0
answers
Comment: C: Bowtie2 end-to-end alignment seems does not work for Fasta files?
... 16 in second position of SAM record means the alignment is reverse. Reverse of "TAAAAAAA" is "TTTTTTTA" that present in read. ...
written 13 months ago by m.koohi.m70
0
votes
0
answers
606
views
0
answers
Comment: C: Bowtie2 end-to-end alignment seems does not work for Fasta files?
... @WouterDeCoster Thanks for suggestion and tutorial. @genomax I am processing metagenomics files and found Bowtie2 too fast. I really didn't tried Blat. You think it is as fast as Bowtie2? @Istvan Albert Thanks for your comment. Actually I am sure that the length of read is not 8. It is 88. I updat ...
written 13 months ago by m.koohi.m70
4
votes
0
answers
606
views
0
answers
Bowtie2 end-to-end alignment seems does not work for Fasta files?
... Hi, I use bowtie2-2.2.9 to align Fasta reads with some genes. I don't know I understand correctly end-to-end alignment in Bowtie2 or not. Based on my understanding if we have a read same as bellow: >Read1 TGCGGAATTTGATACACGTACATAAGTACGTGTTGGCTTATGCTTGCGTACGCTGAAACATGCTGACCTTTTTTTAAAACGCC ...
software error bowtie2 alignment written 13 months ago by m.koohi.m70
5
votes
1
answer
396
views
1
answer
Is there any tool to convert a contig to illumina reads?
... Hi all, I have a weird question! I have some contiges and want to convert them to all possible illumina reads (suppose with length 100). I am wondering if there is any tool to do this? Actually my problem is vise versa of the assembly problem. In assembly problem we have the reads and want to fin ...
assembly contigs illumina written 13 months ago by m.koohi.m70
0
votes
0
answers
386
views
0
answers
Comment: C: Identify kinase that phosphorylates/dephosphorylates a specific protein
... Thanks Lars, Yes, the problem is all of the databases are for eukaryotic as I checked. I actually know the phosphorylation site. You think it can helpful to find at least the type of kinase? ...
written 16 months ago by m.koohi.m70
2
votes
0
answers
386
views
0
answers
Identify kinase that phosphorylates/dephosphorylates a specific protein
... Dear friends, I am wondering if there is any bioinformatic approach or database to find the kinase that phosphorylates/dephosphorylates a specific protein? I have a protein of E.Coli and want to find which kinase potentially can phosphorylates/dephosphorylates it. Thank you, ...
gene protein kinase phosphorylate written 16 months ago by m.koohi.m70

Latest awards to m.koohi.m

Popular Question 8 months ago, created a question with more than 1,000 views. For How can find a list of genes are neighbour?
Popular Question 8 months ago, created a question with more than 1,000 views. For How can find conserved domains of protein's sequence offline?
Popular Question 12 months ago, created a question with more than 1,000 views. For How can find a list of genes are neighbour?
Popular Question 14 months ago, created a question with more than 1,000 views. For How can find a list of genes are neighbour?
Supporter 2.6 years ago, voted at least 25 times.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1378 users visited in the last hour