User: m.koohi.m

gravatar for m.koohi.m
m.koohi.m110
Reputation:
110
Status:
Trusted
Location:
United States
Last seen:
4 months, 2 weeks ago
Joined:
4 years, 8 months ago
Email:
m********@gmail.com

Posts by m.koohi.m

<prev • 36 results • page 1 of 4 • next >
0
votes
0
answers
37
views
0
answers
Comment: C: Can we use mouse reference genome to perform DGE analysis of Zebrafish rna-seq s
... haha! not really! It was really my question! ...
written 5 months ago by m.koohi.m110
0
votes
0
answers
37
views
0
answers
Comment: C: Can we use mouse reference genome to perform DGE analysis of Zebrafish rna-seq s
... Thanks. Seriously and simply thanks! ...
written 5 months ago by m.koohi.m110
0
votes
2
answers
2.9k
views
2
answers
Comment: C: Cosmic And 1000 Genomes Variants
... Thanks for your complete answer! ...
written 12 months ago by m.koohi.m110
1
vote
1
answer
906
views
1
answer
How can run cd-hit-est with a clstr threshold less than 0.8?
... Dear friends, I try to run cd-hit-est with a cluster threshold less than 0.8 but every time I get the following error: > Fatal Error: invalid clstr threshold, should >=0.8 Program halted !! I tried: cd-hit-est -i seq.fasta -o out.fasta -d 0 -T 10 -g 1 -M 10000 -c 0.6 -n 4 This comman ...
cluster tools cd-hit written 18 months ago by m.koohi.m110 • updated 7 months ago by NPalopoli280
0
votes
0
answers
618
views
0
answers
Is there any REST API for the tree view result of the NCBI Blast?
... Hi there, Using Biopython API I can blast my query seq against NCBI database and get the result same as bellow: from Bio.Blast import NCBIWWW result_handle = NCBIWWW.qblast("blastn", "nt", 'gagtctcctttggaactctgcaggttctatttgctttttcccagatgagctctttttctggtgtttgtct') Now I need the tree view o ...
ncbi python biopython blast written 22 months ago by m.koohi.m110
9
votes
1
answer
2.3k
views
1
answer
What "chrUn" stand for in UCSC genome browser web server?
... In UCSC genome browser web server there are some chromosome which start with "chrUn", for example chrUn_KI270438v1. What are these chromosome exactly? It means Unknown chromosome? If yes, why unknown? ...
genome gene ucsc written 2.0 years ago by m.koohi.m110 • updated 8 weeks ago by Biostar ♦♦ 20
1
vote
1
answer
584
views
1
answer
Does anyone have a cheatsheet to compare Usearch and Bowtie2 performance in different situation?
... I am wondering if anyone has a cheat sheet or paper that compare Usearch and Bowtie2 performance? I really like to know which one is more robust in different situation. For example I want to search short reads against a database of some contigs with length 150-400. Do you have any suggestion which o ...
usearch bowtie2 next-gen alignment written 2.1 years ago by m.koohi.m110 • updated 2.1 years ago by h.mon27k
0
votes
0
answers
1.1k
views
0
answers
Comment: C: Bowtie2 end-to-end alignment seems does not work for Fasta files?
... 16 in second position of SAM record means the alignment is reverse. Reverse of "TAAAAAAA" is "TTTTTTTA" that present in read. ...
written 2.2 years ago by m.koohi.m110
0
votes
0
answers
1.1k
views
0
answers
Comment: C: Bowtie2 end-to-end alignment seems does not work for Fasta files?
... @WouterDeCoster Thanks for suggestion and tutorial. @genomax I am processing metagenomics files and found Bowtie2 too fast. I really didn't tried Blat. You think it is as fast as Bowtie2? @Istvan Albert Thanks for your comment. Actually I am sure that the length of read is not 8. It is 88. I updat ...
written 2.2 years ago by m.koohi.m110
4
votes
0
answers
1.1k
views
0
answers
Bowtie2 end-to-end alignment seems does not work for Fasta files?
... Hi, I use bowtie2-2.2.9 to align Fasta reads with some genes. I don't know I understand correctly end-to-end alignment in Bowtie2 or not. Based on my understanding if we have a read same as bellow: >Read1 TGCGGAATTTGATACACGTACATAAGTACGTGTTGGCTTATGCTTGCGTACGCTGAAACATGCTGACCTTTTTTTAAAACGCC ...
software error bowtie2 alignment written 2.2 years ago by m.koohi.m110

Latest awards to m.koohi.m

Popular Question 4 months ago, created a question with more than 1,000 views. For Is there any aging-related gene expression database for human?
Student 5 months ago, asked a question with at least 3 up-votes. For What "chrUn" stand for in UCSC genome browser web server?
Popular Question 12 months ago, created a question with more than 1,000 views. For Is there any aging-related gene expression database for human?
Popular Question 12 months ago, created a question with more than 1,000 views. For How can find a list of genes are neighbour?
Popular Question 12 months ago, created a question with more than 1,000 views. For How can find a list of genes are neighbour?
Popular Question 21 months ago, created a question with more than 1,000 views. For How can find a list of genes are neighbour?
Popular Question 21 months ago, created a question with more than 1,000 views. For How can find conserved domains of protein's sequence offline?
Popular Question 2.1 years ago, created a question with more than 1,000 views. For How can find a list of genes are neighbour?
Popular Question 2.3 years ago, created a question with more than 1,000 views. For How can find a list of genes are neighbour?
Supporter 3.7 years ago, voted at least 25 times.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 562 users visited in the last hour