User: Kai_Qi

gravatar for Kai_Qi
Kai_Qi100
Reputation:
100
Status:
Trusted
Location:
Chicago, IL
Last seen:
1 week, 6 days ago
Joined:
5 years, 11 months ago
Email:
q***********@gmail.com

Posts by Kai_Qi

<prev • 170 results • page 1 of 17 • next >
0
votes
1
answer
111
views
1
answers
Comment: C: MEME cannot handle 318 sequence?
... Thanks for reply. I tried it by using maxsize 0. still get the same results, I just tried to use the first 100 line to run the code, it worked well. I guess my sequence plus the number of sequences exceed the limit of meme; then i tried too add a number of -maxsize 200000, it starts running. ...
written 20 days ago by Kai_Qi100
2
votes
1
answer
111
views
1
answer
MEME cannot handle 318 sequence?
... Hi: I put a fasta file for MEME like this: meme input.fasta -mod anr -oc MEME_no_control_motif10 -rna -nmotifs 10 -minw 6 -maxw 10 > log4 2> error4 cat error4 Dataset too large (> 100000). Rerun with larger -maxsize. The fasta contains about 318 sequences: wc -l input ...
genome chip-seq rna-seq sequencing written 21 days ago by Kai_Qi100 • updated 20 days ago by Alex Reynolds31k
1
vote
0
answers
152
views
0
answers
how to do GeneOntology in R using DAVID or other packages to recommed?
... Hi all: I have an gene list after analyzing the dynamic expression. I separated them when generating clusters using arbitory numbers, say I generated 3 clusters after trying different numbers, and this cluster is so far satisfying. I have written the files so I know which gene belongs to which cl ...
gene R rna-seq written 24 days ago by Kai_Qi100
1
vote
1
answer
229
views
1
answer
Linear regression of the RNAseq results to get the genes whose expression change belong to the same trends
... I have samples across 4 different developmental stages, each stage has 2 replicates. Using DEseq2, I can get the trending line of the counts of each gene, below is the code I have run: library(DESeq2) sampleTable <- as.data.frame(sampleTable) countdata <- read.csv("CSHLRNASeq_coun ...
R rna-seq sequencing written 29 days ago by Kai_Qi100 • updated 29 days ago by thyleal150
1
vote
1
answer
389
views
1
answers
Answer: C: Deseq2: time series in 1 condition. Error in nbinomLRT(object, full = full, redu
... Here is the link for the [answer][1]: [1]: https://www.biostars.org/p/343893/ ...
written 29 days ago by Kai_Qi100
0
votes
1
answer
389
views
1
answers
Comment: C: Deseq2: time series in 1 condition. Error in nbinomLRT(object, full = full, redu
... Sorry for posting it again: I found the answer Kevin has shown before: `dds <- DESeq(dds, test = 'LRT', reduced = ~ 1)` works with no error. ...
written 4 weeks ago by Kai_Qi100
1
vote
1
answer
389
views
1
answer
Deseq2: time series in 1 condition. Error in nbinomLRT(object, full = full, reduced = reduced, quiet = quiet
... I am using DEseq2 to do differential analysis from RNA-seq data across 4 developmental stages, each stages have 2 replicates. I can following through the manual to do comparisons between each two stages. Now I want to do the comparison across 4 stages in a time series manner so that I can know the g ...
R next-gen rna-seq sequencing written 4 weeks ago by Kai_Qi100
0
votes
1
answer
123
views
1
answers
Comment: C: Removing ">" before coordinates and separate the coordinates in a single string
... The solutions worked. Thanks a lot. ...
written 5 weeks ago by Kai_Qi100
0
votes
1
answer
123
views
1
answers
Comment: C: Removing ">" before coordinates and separate the coordinates in a single string
... I found the answer to the first part: I used `$ sed 's/>//' mycoord.csv > mycoord_1.csv` to remove ">" $ head mycoord_1.csv 16:23107820-23108019(+) 14:54909471-54909670(-) 7:127020805-127021004(-) X:20848619-20848818(+) 1:75547398-75547597(+) 11:102777648-102777 ...
written 5 weeks ago by Kai_Qi100
1
vote
1
answer
123
views
1
answer
Removing ">" before coordinates and separate the coordinates in a single string format into a bed file
... I have a fasta file that contains the coordinates and the sequence of the coordinates: head my.fasta >16:23107820-23108019(+) GTACGGCGCTCCCGGGGCGGCCGGTGGCCTGTAGTCAAGGTCACTAGGACCCGCGTTGAGGTGGGTTGCTTGGCGGCCACACTGCAGGTATGCGGGCTTTTTCTTAGGGCACACACTTCTCCTTGTGCCCTTCGAGAAGCTTCCATGATGGTAAGACT ...
gene next-gen sequence rna-seq written 5 weeks ago by Kai_Qi100

Latest awards to Kai_Qi

Centurion 7 months ago, created 100 posts.
Supporter 8 months ago, voted at least 25 times.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1860 users visited in the last hour
_