User: tlorin

gravatar for tlorin
Last seen:
2 days, 19 hours ago
2 years, 4 months ago

Posts by tlorin

<prev • 39 results • page 1 of 4 • next >
Comment: C: Scientific Names In Blast Output And Databases
... @Carlos, I owe you a beer! ...
written 17 days ago by tlorin170
Comment: C: Cutadapt not trimming adapters in PE mode
... Thanks @Brian! It's much clearer. So if I understand correctly, I should run ` in1=subset.R1.fastq in2=subset.R2.fastq out1=subset.R1.trim.fastq out2=subset.R2.trim.fastq literal=AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT ktrim=r k=23 mink= ...
written 4 weeks ago by tlorin170
Cutadapt not trimming adapters in PE mode
... Hello all, Please apologies if this is a trivial question regarding cutadapt but it is the first time I am running this program. I have 2 PE Illumina Hiseq4000 files (100nt) with many many reads. I take a subset of 100,000 sequences for left and right reads. The sequencing platform told me the for ...
rna-seq cutadapt written 7 weeks ago by tlorin170 • updated 7 weeks ago by h.mon7.2k
Comment: C: Mapping RNA-Seq data on genome from another species
... Thanks Brian! If I add `maxindel=200k minid=0.7` do I risk mapping to spurious locations or will the mapping report the best unique hit (so, the homologous sequence in my case)? ...
written 9 weeks ago by tlorin170
Comment: C: Mapping RNA-Seq data on genome from another species
... Thanks for your answer! But why `--outFilterMismatchNmax 8`and not `--outFilterMismatchNmax 15` or over threshold? Is this some arbitrary threshold that you found was best? I guess this depends on the evolutionary distance between both species too. Is [this][1] the post you refer to? [1]: https: ...
written 9 weeks ago by tlorin170
5 follow
Mapping RNA-Seq data on genome from another species
... Hello all, I have RNA-Seq data from a species **A** for which I don't have a reference genome. I would like to map this data on the closest available genome from species **B**. I have read [this post][1] and I am planning to use `hisat2` or `STAR`. Does any of you have recommandations regarding t ...
genome hisat2 star rna-seq mapping written 9 weeks ago by tlorin170 • updated 9 weeks ago by Brian Bushnell13k
Comment: C: Fasta to gff with custom set of genes
... `I don't agree completely. If your reads are RNASeq reads and you map them against a transcriptome, it shouldn't be a problem.` Definitely! Was just saying that you have to map your reads to a whole genome or transcriptome, not to "simply" 100 or 200 genes. ...
written 3 months ago by tlorin170
Fasta to gff with custom set of genes
... Dear all, I have a custom list of 100 genes that I manually curated to obtain the full CDS and I would like to make differential expression (DE) analysis between samples for this very subset. I now I cannot simply map all the reads onto this subset and perform DE analysis because I would have [norm ...
fasta genome gff deseq2 rna-seq written 3 months ago by tlorin170 • updated 3 months ago by Macspider1.2k
Comment: C: Why the local blast and online blast produce different results?
... Thanks for this solution @Juke-34. Indeed, the command line default parameter for `blastn` is 28, whereas the online default parameter is 11... ...
written 6 months ago by tlorin170
Comment: C: Understanding NCBI identifiers
... I know that nr is supposed to be non-redundant (that's why I use it), but then why are there only 2 hits left (NP_001133180.1 and NP_001133181.1) when we blast the sequence onto the RefSeq database? Which one should I trust 'in general'? It seems to be that everyone has a 'feeling' about this but I ...
written 10 months ago by tlorin170

Latest awards to tlorin

Voter 12 weeks ago, voted more than 100 times.
Good Answer 6 months ago, created an answer that was upvoted at least 5 times. For A: Tajima's D value interpretation
Appreciated 8 months ago, created a post with more than 5 votes. For A: Tajima's D value interpretation
Popular Question 10 months ago, created a question with more than 1,000 views. For Fasta to axt - KaKs Calculator
Popular Question 20 months ago, created a question with more than 1,000 views. For Heatmap with categorical variables and with phylogenetic tree in R or Python
Scholar 20 months ago, created an answer that has been accepted. For A: Heatmap with categorical variables and with phylogenetic tree in R or Python
Supporter 21 months ago, voted at least 25 times.
Teacher 2.4 years ago, created an answer with at least 3 up-votes. For A: Heatmap with categorical variables and with phylogenetic tree in R or Python
Teacher 2.4 years ago, created an answer with at least 3 up-votes. For A: Heatmap with categorical variables and with phylogenetic tree in R or Python
Scholar 2.4 years ago, created an answer that has been accepted. For A: Heatmap with categorical variables and with phylogenetic tree in R or Python


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 469 users visited in the last hour