User: caizexi123

gravatar for caizexi123
caizexi12340
Reputation:
40
Status:
New User
Location:
Denmark
Last seen:
2 months, 1 week ago
Joined:
2 years, 1 month ago
Email:
c*********@gmail.com

Posts by caizexi123

<prev • 26 results • page 1 of 3 • next >
0
votes
1
answer
342
views
1
answers
Comment: C: Big Genome Assembly of Medicinal Plant
... You can edit the assemble.sh script and decrease $JF_SIZE, in your case it will take much more than what you have. But to be honest, MaSuRCA will take more than 1.2TB. ...
written 11 weeks ago by caizexi12340
0
votes
1
answer
1.0k
views
1
answers
Comment: C: SSPACE file error
... You can try to change the aligner in the library file, for example, bowtie or bwasw. I remember sometimes SSPACE will have some troblue with one of the aligners. Or you can use older version of SSPACE. ...
written 12 weeks ago by caizexi12340
0
votes
1
answer
342
views
1
answers
Comment: C: Big Genome Assembly of Medicinal Plant
... Hi, First you should try to know how much percent of your genome is repeat and whether your sample is inbread line. And there are some parameters will affect the result of assembly, you should try different parameters. Also the pre-process,like trimed reads, remove contamination and error correct wi ...
written 12 weeks ago by caizexi12340
1
vote
1
answer
225
views
1
answer
Optical mapping service company or lab
... Dear all, Hi! Does anyone know which company of lab provide a good service for Optical mapping? ...
genome assembly next-gen written 5 months ago by caizexi12340 • updated 5 months ago by Daniel Swan13k
0
votes
1
answer
270
views
1
answers
Comment: C: orthologs between mouse and blind mole rat
... No. The online service will do everything. The input is the full protein sequence of blind mole rate, the output is the orthologs groups for each protein. Then you can analyze which of the orthologs groups mouse have. ...
written 5 months ago by caizexi12340
0
votes
1
answer
270
views
1
answers
Comment: C: orthologs between mouse and blind mole rat
... If you have the all the blind mole rate protein sequences, you can use OrthogMCL online service, and you can extract all the orthologs with mouse ...
written 5 months ago by caizexi12340
1
vote
0
answers
223
views
0
answers
Comment: C: MaSuRCA mate pair libraries crashing
... A quick way to find out whether your data is mate-pair reads. Circularized Duplicate Junction Adapter CTGTCTCTTATACACATCTAGATGTGTATAAGAGACAG Circularized Single Junction Adapter CTGTCTCTTATACACATCT Circularized Single Junction Adapter Reverse Complement AGATGTGTATAAGAGACAG using ' grep "one o ...
written 5 months ago by caizexi12340
0
votes
0
answers
223
views
0
answers
Comment: C: MaSuRCA mate pair libraries crashing
... The library construction for mate-pair and pair-end is different. And based on the insert size "500", it seems pair-end. So you either asked the people who sequenced the data or map your reads to close-relate species to estimate the insert size. PS, you can run MaSurCA with pre-process data even the ...
written 5 months ago by caizexi12340
0
votes
0
answers
223
views
0
answers
Comment: C: MaSuRCA mate pair libraries crashing
... It seems the RAM problem, you even not yet generate the jellyfish output. You should check "error_correct.log". ...
written 5 months ago by caizexi12340
0
votes
1
answer
307
views
1
answers
Comment: C: Any alternative for SSPACE-longreads or any suggestion to speed up
... AHA is part of SMRT Analysis, it seems too complicate to setup. I will try after the PBJelly finish. ...
written 6 months ago by caizexi12340

Latest awards to caizexi123

Popular Question 4 months ago, created a question with more than 1,000 views. For Error while abyss running on cluster

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 489 users visited in the last hour