Moderator: Josh Herr

gravatar for Josh Herr
Josh Herr5.6k
Reputation:
5,580
Status:
Trusted
Location:
University of Nebraska
Website:
http://joshuaherr.com/
Twitter:
@number_three
Scholar ID:
Google Scholar Page
Last seen:
1 week, 4 days ago
Joined:
7 years, 3 months ago
Email:
j************@gmail.com

I'm an assistant professor in the Department of Plant Pathology and The Center for Plant Science Innovation at the University of Nebraska.

You can read more about me and my interests at my blog Cyme & Cystidium or at my personal website or the website of my research lab.

You can also find me at Github, Software & Data Carpentry, and Twitter.

Posts by Josh Herr

<prev • 566 results • page 1 of 57 • next >
0
votes
2
answers
134
views
2
answers
Comment: C: Split ordered fasta file by alphabetical group using awk
... Absolutely... The original file is over 3 million sequences ordered like this: ``` >A_sp 8272638 AGGAGAGAGAAGCTGGGACTACTA >A_sp_2 3882626 AGGAGAGAGAAGGGGGGACTACTA >A_sp_3 9748636 AGGAGAGAGAAGCTACTACTGGGA >B_sp 29384723 AGGAGAGAGAAGCTACTGGGGCTA >M_sp 2863762 AGGAGAGAGAAGCTACTACTACTA ...
written 11 days ago by Josh Herr5.6k
4
votes
2
answers
134
views
2
answers
Split ordered fasta file by alphabetical group using awk
... I know there are a ton of awk one-liners on here for splitting a fasta file, but here's one I have not been able to get to work or find an answer for. A simple tool would be helpful, but I tried to use ```pyfasta``` and ```seqtk``` to no avail. Please excuse me if someone has answered this one b ...
fasta one-liner awk written 11 days ago by Josh Herr5.6k • updated 11 days ago by cpad01127.7k
3
votes
0
answers
134
views
0
answers
Benchmarking single SNP mapping
... I've come up with a homework exercise for my class on SNP mapping and benchmarking. The comical part is I can't figure out why I am not mapping the SNP myself. I'm not a novice at this anymore, but I'm banging my head against the wall to get this to work. For the exercise, I have taken a 13,000 bp ...
snps bowtie wgsim bwa mapping written 11 weeks ago by Josh Herr5.6k • updated 9 weeks ago by Biostar ♦♦ 20
0
votes
0
answers
323
views
0
answers
Comment: C: Relabel/rename OTU IDs in an OTU table using a taxonomy file
... This should be a pretty easy conversion. Do you mind updating the text in your question to show what you have exactly and what is your desired formatted output? There are lots of ways using [biom-format][1] to add taxonomy to an OTU table, but what you might want to be done could also be done easi ...
written 4 months ago by Josh Herr5.6k
0
votes
3
answers
1.3k
views
3
answers
Answer: C: Get phylogenetic tree from abundance table
... In addition to the other two answers, I'm going to chime in. I'm not being critical here, but it sounds like you are a little confused. It looks like what you show above is the taxonomy table from your OTU picking pipeline. This can be "made" into a phylogenetic tree, but you'll have to have your ...
written 15 months ago by Josh Herr5.6k
0
votes
2
answers
518
views
2
answers
Answer: A: Change maximum number of sequences on source code of ClaustalW
... I'm pretty sure you can run as much sequence data as possible through ClustalW, not that it has the memory to handle it. I do not see a flag for adjusting the memory of ClustalW. What have you tried? Have you tried to run all your data through ClustalW? You might be confined by your computer memor ...
written 18 months ago by Josh Herr5.6k
1
vote
1
answer
962
views
1
answers
Answer: A: Easy way to automatically save images of Krona HTML charts?
... I agree with the above answers as different tools selectively parse SVG in various ways. I have had good luck with [SVG Crowbar][1]. I then take the SVG output and use Illustrator or Inkscape to modify for publication. [1]: http://nytimes.github.io/svg-crowbar/ ...
written 20 months ago by Josh Herr5.6k
1
vote
1
answer
505
views
1
answers
Answer: A: Correcting for functional annotation database bias
... We recognize the bias and discuss it. I'm not aware of any efforts to account or quantify these biases yet. Much of our ability to understand this bias relies on laboratory validation and experiments to identify unknown functions, so we have a lot of work to do to fill in these gaps. ...
written 21 months ago by Josh Herr5.6k
1
vote
8
answers
67k
views
8
answers
Comment: C: How to download raw sequence data from GEO/SRA
... Whoa!  How did I not know about prefetch - that is super handy.  Thanks for this tutorial. ...
written 2.7 years ago by Josh Herr5.6k
4
votes
2
answers
1.1k
views
2
answers
Answer: A: Confirmation of metagenomic data
... 1) Does this sound reasonable, too strict, not strict enough? I'm a little thrown off by your question -- of course genomes from mixed samples are real genomes.  You're trying to establish standards with which to describe new species of viruses from metagenomic data.  There are already a lot of gro ...
written 2.9 years ago by Josh Herr5.6k

Latest awards to Josh Herr

Great Question 11 weeks ago, created a question with more than 5,000 views. For BioPython: convert fasta to fastq without quality score input file
Appreciated 4 months ago, created a post with more than 5 votes. For A: Software For Analysis Of Bacterial Genomics.
Teacher 8 months ago, created an answer with at least 3 up-votes. For A: How To Be Helpful As A Biostar Moderator/Editor?
Epic Question 13 months ago, created a question with more than 10,000 views. For BioPython: convert fasta to fastq without quality score input file
Teacher 13 months ago, created an answer with at least 3 up-votes. For A: How To Be Helpful As A Biostar Moderator/Editor?
Appreciated 18 months ago, created a post with more than 5 votes. For A: Software For Analysis Of Bacterial Genomics.
Good Answer 20 months ago, created an answer that was upvoted at least 5 times. For A: Career Plan: Be A Dual Benchworker And Bioinformatician
Good Answer 21 months ago, created an answer that was upvoted at least 5 times. For A: Career Plan: Be A Dual Benchworker And Bioinformatician
Student 2.0 years ago, asked a question with at least 3 up-votes. For BioPython: convert fasta to fastq without quality score input file
Great Question 2.0 years ago, created a question with more than 5,000 views. For BioPython: convert fasta to fastq without quality score input file
Teacher 2.0 years ago, created an answer with at least 3 up-votes. For A: How To Be Helpful As A Biostar Moderator/Editor?
Appreciated 2.0 years ago, created a post with more than 5 votes. For A: Software For Analysis Of Bacterial Genomics.
Good Answer 2.1 years ago, created an answer that was upvoted at least 5 times. For A: Career Plan: Be A Dual Benchworker And Bioinformatician
Teacher 2.5 years ago, created an answer with at least 3 up-votes. For A: How And From Where Do I Download Reference Genome For Staphylococcus Aureus?
Commentator 2.5 years ago, created a comment with at least 3 up-votes. For C: Bioinformatics Job With A Bsc
Teacher 2.5 years ago, created an answer with at least 3 up-votes. For A: Science Games For Citizen Science And Educational Purposes
Teacher 2.5 years ago, created an answer with at least 3 up-votes. For A: How To Be Helpful As A Biostar Moderator/Editor?
Great Question 2.6 years ago, created a question with more than 5,000 views. For BioPython: convert fasta to fastq without quality score input file
Teacher 2.9 years ago, created an answer with at least 3 up-votes. For A: How To Be Helpful As A Biostar Moderator/Editor?
Scholar 3.0 years ago, created an answer that has been accepted. For A: Example of complete de novo genome assembly of ion torrent reads
Scholar 3.1 years ago, created an answer that has been accepted. For A: Example of complete de novo genome assembly of ion torrent reads
Teacher 3.1 years ago, created an answer with at least 3 up-votes. For A: How Could I Run A Huge Number Of Blast Calls Faster?
Scholar 3.2 years ago, created an answer that has been accepted. For A: Example of complete de novo genome assembly of ion torrent reads
Scholar 3.2 years ago, created an answer that has been accepted. For A: Example of complete de novo genome assembly of ion torrent reads
Commentator 3.2 years ago, created a comment with at least 3 up-votes. For C: Bioinformatics Job With A Bsc

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 758 users visited in the last hour