Moderator: Josh Herr

gravatar for Josh Herr
Josh Herr5.7k
University of Nebraska
Scholar ID:
Google Scholar Page
Last seen:
2 months ago
9 years, 6 months ago

I'm an assistant professor in the Department of Plant Pathology and The Center for Plant Science Innovation at the University of Nebraska.

You can read more about me and my interests at my blog Cyme & Cystidium or at my personal website or the website of my research lab.

You can also find me at Github, Software & Data Carpentry, and Twitter.

Posts by Josh Herr

<prev • 569 results • page 1 of 57 • next >
Answer: A: Shotgun metagenomics high duplication read rate - how high is too high?
... When you say "duplication" rate, you mean read depth, right? There are a few options here -- ideally you want high depth for assembly, but if you have too much data you'll max out on your assembly memory. Gut shotgun metagenome data is typically not very complex when compared to soil, so I am surpr ...
written 13 months ago by Josh Herr5.7k
Comment: C: Quick One Liner For Fastq Header Renaming
... Thanks for pointing that one out for posterity! When I asked the question 6.4 years ago the ```seqtk``` tool did not exist! ...
written 13 months ago by Josh Herr5.7k
Comment: C: interpreting fasta header
... Hi Lena, Can you tell us the tool that provided those fasta headers for you? That might help us know what "Tcount", "Acount" and "Bcount" mean. Thanks! ...
written 21 months ago by Josh Herr5.7k
Comment: C: Split ordered fasta file by alphabetical group using awk
... Absolutely... The original file is over 3 million sequences ordered like this: ``` >A_sp 8272638 AGGAGAGAGAAGCTGGGACTACTA >A_sp_2 3882626 AGGAGAGAGAAGGGGGGACTACTA >A_sp_3 9748636 AGGAGAGAGAAGCTACTACTGGGA >B_sp 29384723 AGGAGAGAGAAGCTACTGGGGCTA >M_sp 2863762 AGGAGAGAGAAGCTACTACTACTA ...
written 2.3 years ago by Josh Herr5.7k
Split ordered fasta file by alphabetical group using awk
... I know there are a ton of awk one-liners on here for splitting a fasta file, but here's one I have not been able to get to work or find an answer for. A simple tool would be helpful, but I tried to use ```pyfasta``` and ```seqtk``` to no avail. Please excuse me if someone has answered this one b ...
fasta one-liner awk written 2.3 years ago by Josh Herr5.7k • updated 2.3 years ago by cpad011214k
Benchmarking single SNP mapping
... I've come up with a homework exercise for my class on SNP mapping and benchmarking. The comical part is I can't figure out why I am not mapping the SNP myself. I'm not a novice at this anymore, but I'm banging my head against the wall to get this to work. For the exercise, I have taken a 13,000 bp ...
snps bowtie wgsim bwa mapping written 2.5 years ago by Josh Herr5.7k • updated 2.5 years ago by Biostar ♦♦ 20
Comment: C: Relabel/rename OTU IDs in an OTU table using a taxonomy file
... This should be a pretty easy conversion. Do you mind updating the text in your question to show what you have exactly and what is your desired formatted output? There are lots of ways using [biom-format][1] to add taxonomy to an OTU table, but what you might want to be done could also be done easi ...
written 2.7 years ago by Josh Herr5.7k
Answer: C: Get phylogenetic tree from abundance table
... In addition to the other two answers, I'm going to chime in. I'm not being critical here, but it sounds like you are a little confused. It looks like what you show above is the taxonomy table from your OTU picking pipeline. This can be "made" into a phylogenetic tree, but you'll have to have your ...
written 3.5 years ago by Josh Herr5.7k
Answer: A: Change maximum number of sequences on source code of ClaustalW
... I'm pretty sure you can run as much sequence data as possible through ClustalW, not that it has the memory to handle it. I do not see a flag for adjusting the memory of ClustalW. What have you tried? Have you tried to run all your data through ClustalW? You might be confined by your computer memor ...
written 3.8 years ago by Josh Herr5.7k
Answer: A: Easy way to automatically save images of Krona HTML charts?
... I agree with the above answers as different tools selectively parse SVG in various ways. I have had good luck with [SVG Crowbar][1]. I then take the SVG output and use Illustrator or Inkscape to modify for publication. [1]: ...
written 4.0 years ago by Josh Herr5.7k

Latest awards to Josh Herr

Appreciated 8 months ago, created a post with more than 5 votes. For A: Software For Analysis Of Bacterial Genomics.
Teacher 13 months ago, created an answer with at least 3 up-votes. For A: How To Be Helpful As A Biostar Moderator/Editor?
Popular Question 20 months ago, created a question with more than 1,000 views. For BioPython: convert fasta to fastq without quality score input file
Epic Question 2.3 years ago, created a question with more than 10,000 views. For BioPython: convert fasta to fastq without quality score input file
Teacher 2.3 years ago, created an answer with at least 3 up-votes. For A: How To Be Helpful As A Biostar Moderator/Editor?
Teacher 2.3 years ago, created an answer with at least 3 up-votes. For A: How And From Where Do I Download Reference Genome For Staphylococcus Aureus?
Great Question 2.5 years ago, created a question with more than 5,000 views. For BioPython: convert fasta to fastq without quality score input file
Appreciated 2.7 years ago, created a post with more than 5 votes. For A: Software For Analysis Of Bacterial Genomics.
Teacher 3.0 years ago, created an answer with at least 3 up-votes. For A: How To Be Helpful As A Biostar Moderator/Editor?
Epic Question 3.4 years ago, created a question with more than 10,000 views. For BioPython: convert fasta to fastq without quality score input file
Teacher 3.4 years ago, created an answer with at least 3 up-votes. For A: How To Be Helpful As A Biostar Moderator/Editor?
Appreciated 3.8 years ago, created a post with more than 5 votes. For A: Software For Analysis Of Bacterial Genomics.
Good Answer 4.0 years ago, created an answer that was upvoted at least 5 times. For A: Career Plan: Be A Dual Benchworker And Bioinformatician
Good Answer 4.0 years ago, created an answer that was upvoted at least 5 times. For A: Career Plan: Be A Dual Benchworker And Bioinformatician
Appreciated 4.3 years ago, created a post with more than 5 votes. For A: Software For Analysis Of Bacterial Genomics.
Student 4.3 years ago, asked a question with at least 3 up-votes. For BioPython: convert fasta to fastq without quality score input file
Teacher 4.3 years ago, created an answer with at least 3 up-votes. For A: How To Be Helpful As A Biostar Moderator/Editor?
Great Question 4.3 years ago, created a question with more than 5,000 views. For BioPython: convert fasta to fastq without quality score input file
Good Answer 4.4 years ago, created an answer that was upvoted at least 5 times. For A: Career Plan: Be A Dual Benchworker And Bioinformatician
Commentator 4.8 years ago, created a comment with at least 3 up-votes. For C: Bioinformatics Job With A Bsc
Teacher 4.8 years ago, created an answer with at least 3 up-votes. For A: Science Games For Citizen Science And Educational Purposes
Teacher 4.8 years ago, created an answer with at least 3 up-votes. For A: How And From Where Do I Download Reference Genome For Staphylococcus Aureus?
Teacher 4.8 years ago, created an answer with at least 3 up-votes. For A: How To Be Helpful As A Biostar Moderator/Editor?
Great Question 4.9 years ago, created a question with more than 5,000 views. For BioPython: convert fasta to fastq without quality score input file
Teacher 5.2 years ago, created an answer with at least 3 up-votes. For A: How To Be Helpful As A Biostar Moderator/Editor?


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1778 users visited in the last hour