User: phongphak.06

gravatar for phongphak.06
New User
Last seen:
2 years, 1 month ago
5 years, 1 month ago

Posts by phongphak.06

<prev • 7 results • page 1 of 1 • next >
Stampy: Error while re-mapping with --bamkeepgoodreads parameter
... Hi , I have tried to align WGS reads to viral reference genomes using Stampy software that the command I used is: -t 16 -g viral_ref -h viral_ref --bamkeepgoodreads -M SampleName.bwa.bam -o sample.bwa.stampy.sam Note: This is a hybrid mode which was performed by using an alignment fi ...
software error alignment sequencing written 2.5 years ago by phongphak.0620
Comment: C: Question: Normalization of read counts for Metagenomics data
... This is a gene abundance of an individual sample (not compared to the other samples). ...
written 2.7 years ago by phongphak.0620
Question: Normalization of read counts for Metagenomics data
... Hi, I'm dealing with gene abundance analysis of metagenomics data (whole-genome shotgun seq). So I've done read count by using [featureCounts][1]. Anyway. I have no idea how to normalize since there are a lot of methods use for this purpose and I also have no experience in this analysis. So shou ...
genome R next-gen sequencing assembly written 2.7 years ago by phongphak.0620 • updated 2.7 years ago by colindaven2.2k
Comment: C: How to split forward and reverse reads from one fastq file?
... Thank you! It's a nice idea, but it's not working correctly. Anyway, I had tried this `awk '{if(NR%8 < 4) print}' file.fastq > file_R1.fastq` and it's worked, while I have no idea how to correct the another, since > 4 cannot extract the quality of reads (> 3 and > 5 are still not wor ...
written 2.8 years ago by phongphak.0620
How to split forward and reverse reads from one fastq file?
... Hi, I have a metagenomic reads simulated by [Grinder][1] like this (example): @1/1 reference=NZ_CP009501.1 position=complement(1484183..1484382) description="Methanosarcina thermophila TM-1, complete genome" TAGTCAGTTCTGGCACGAATCCTGTCACACTCTACTTATTTTAAAATCCTTATTTATCACGATTTATATTTATAATTTATTAT ...
sequence next-gen sequencing written 2.8 years ago by phongphak.0620 • updated 2.8 years ago by Brian Bushnell17k
The problem with sensitivity analysis of somatic variant caller
... Hello! I'm working on somatic variant identification from cancer samples. So, I try to simulate Illumina paired-end read with known variants by using VarSim (, which this tools can simulate the human genome with both germline and somatic mutations (use ART tool a ...
next-gen sequence snp sequencing written 4.1 years ago by phongphak.0620 • updated 3.4 years ago by biostarsjic0
PacBio CCS read denovo assembly failed
... Hello! I'm beginning to the field of bioinformatics (I'm 1st year student in bioinformatics and systems biology program) and I got uncorrected PacBio sequences from Xylaria sp. consist of 64 files are bax.h5, CCS reads, filtered_subreads and filtered_subreads_longest which I assembled by using celer ...
genome assembly next-gen alignment sequencing written 5.2 years ago by phongphak.0620 • updated 5.1 years ago by orange30

Latest awards to phongphak.06

Popular Question 2.7 years ago, created a question with more than 1,000 views. For PacBio CCS read denovo assembly failed


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2071 users visited in the last hour