User: Louis Kok

gravatar for Louis Kok
Louis Kok20
Reputation:
20
Status:
New User
Location:
Singapore
Last seen:
10 months, 1 week ago
Joined:
5 years, 10 months ago
Email:
e*********@gmail.com

Posts by Louis Kok

<prev • 46 results • page 1 of 5 • next >
0
votes
1
answer
237
views
1
answer
Removal of sequences that is partial of a longer sequences in multifasta file
... Hi. I wish to remove any sequence that is partial of a longer sequence in multifasta file. For example, let say I have three sequences below: >seq1 ACGACGATCGT**ACTAGCATCGAGCGTAC**TACGTAGCGCGT >seq2 **ACTAGCATCGAGCGTAC** >seq3 AGCAGCGTACGTGACTACGACGATCTACG ...
sequence written 10 months ago by Louis Kok20 • updated 10 months ago by Ram32k
0
votes
0
answers
151
views
0
answers
Elongation factor-alpha gene database
... Hi. I have been looking for Elongation factor-alpha full gene sequences for all fungi. When I searched the NCBI nucleotide database all I got are either cds or mRNA. Is there a database or resources where I can acquired the full gene sequences from? Thanks in advance. ...
gene database sequence written 12 months ago by Louis Kok20
0
votes
1
answer
209
views
1
answers
Comment: C: Issues in running command line blastn with -task blastn-short option
... @lieven.sterck. Nothing much special. I was trying to match sequences with different composition of primers and realised that I could not do it with more primer sequences and had not clue why. ...
written 13 months ago by Louis Kok20
1
vote
1
answer
209
views
1
answers
Comment: C: Issues in running command line blastn with -task blastn-short option
... It works when I tried e-value cutoff of 13. The output is as below: BLASTN 2.6.0+ Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of ...
written 13 months ago by Louis Kok20
0
votes
1
answer
209
views
1
answers
Comment: C: Issues in running command line blastn with -task blastn-short option
... The original 32 sequences are different. For simplicity, I created a database of 32 duplicates as `db.fa` and 26 duplicates for `db.partial.fa`. Therefore, for `db.fa`, it looks like this (As you can see, they are all the same): >DB_01 CTTGGTCATTTAGAGGAAGTAA >DB_02 CTTGGTCATTT ...
written 13 months ago by Louis Kok20
0
votes
1
answer
209
views
1
answers
Comment: C: Issues in running command line blastn with -task blastn-short option
... My apologies. It was version 2.6.0 not 2.2.18. I will correct it. It produces no hit using normal `blastn` as well. The `makeblastdb` output is as below: makeblastdb -in db.fa -dbtype nucl -parse_seqids Building a new DB, current time: 02/06/2020 08:10:51 New DB name: /opt/louis/db ...
written 13 months ago by Louis Kok20
1
vote
1
answer
209
views
1
answer
Issues in running command line blastn with -task blastn-short option
... Hi, I am using BLAST command line tool version 2.6.0. I have a short sequence database db.fa which consists of 32 sequences with 22 bp. I executed the query data query.fa against db.fa and it shows no hit. However, when I reduce the database to random 26 sequences and created db.partial.fa, it sh ...
ncbi blast written 13 months ago by Louis Kok20
0
votes
0
answers
297
views
0
answers
Download complete list of bacterial and eukaryotic species from NIH Human Microbiome Project
... Hi, I would like to download a complete list of species from NIH human microbiome project database. What is the best way to get the list as I am not interested in the details. The website is as below: https://www.hmpdacc.org/hmp/resources/download.php By the way, is there any other good resources ...
nih human microbiome written 17 months ago by Louis Kok20
0
votes
1
answer
582
views
1
answers
Comment: C: Column explanation for repeat database from UCSC
... Hi @RamRS. Added a few lines. ...
written 20 months ago by Louis Kok20
0
votes
1
answer
582
views
1
answer
Column explanation for repeat database from UCSC
... I was looking into the repeat database from UCSC as below: http://hgdownload.cse.ucsc.edu/goldenPath/hg19/database/rmsk.txt.gz This file does not contain a header. Can I check what those columns are so that I can better understanding the meaning? Thanks in advance. A few lines of the file is a ...
repeats rmsk ucsc written 20 months ago by Louis Kok20 • updated 20 months ago by finswimmer14k

Latest awards to Louis Kok

Popular Question 19 months ago, created a question with more than 1,000 views. For Hierarchical ranking of gene ontology
Great Question 2.2 years ago, created a question with more than 5,000 views. For Multiple asterisks inside amino acid fasta sequences
Popular Question 2.4 years ago, created a question with more than 1,000 views. For Hierarchical ranking of gene ontology
Popular Question 2.5 years ago, created a question with more than 1,000 views. For Hierarchical ranking of gene ontology
Popular Question 4.5 years ago, created a question with more than 1,000 views. For Hierarchical ranking of gene ontology
Popular Question 4.5 years ago, created a question with more than 1,000 views. For TargetP Error: zero output generated
Popular Question 4.5 years ago, created a question with more than 1,000 views. For BLAST result is different between Sanger forward and reverse reads
Popular Question 4.5 years ago, created a question with more than 1,000 views. For How to interpret the outputs generated from bamtobed using BedTools?
Popular Question 4.5 years ago, created a question with more than 1,000 views. For Obtain heterozyous/IUPAC consensus sequences from multiple sequence alignment
Popular Question 4.5 years ago, created a question with more than 1,000 views. For Convert alignment in Fasta/Clustal format to SAM/BAM file
Popular Question 4.5 years ago, created a question with more than 1,000 views. For 16S rRNA database for human clinical pathogens?
Popular Question 4.8 years ago, created a question with more than 1,000 views. For Convert alignment in Fasta/Clustal format to SAM/BAM file
Popular Question 4.9 years ago, created a question with more than 1,000 views. For Convert alignment in Fasta/Clustal format to SAM/BAM file

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1583 users visited in the last hour
_