User: Beeth

gravatar for Beeth
Beeth170
Reputation:
170
Status:
New User
Location:
Last seen:
9 years, 1 month ago
Joined:
9 years, 5 months ago
Email:
s**********@gmail.com

Posts by Beeth

<prev • 12 results • page 1 of 2 • next >
0
votes
2
answers
3.0k
views
2
answers
Comment: C: Default Ncbi Blast+ V. 2.2.25 Parameters
... yes I am only interested in DNA-DNA comparisons (blastn). ...
written 9.3 years ago by Beeth170
4
votes
2
answers
3.0k
views
2
answers
Default Ncbi Blast+ V. 2.2.25 Parameters
... Hi: I'd like to compare my own BLAST tool with NCBI blast+ tool but couldn't find the default parameter of this version. I'd like to know the scoring scheme for match, mismatch, opening gap and extended gap. I've created a NCBI blast+ output and it prints at the end of the file: Matrix: blastn ma ...
ncbi scoring blast written 9.3 years ago by Beeth170 • updated 9.3 years ago by Käpt'N Silico20
0
votes
1
answer
5.5k
views
1
answers
Comment: C: E-Value In Blast
... Additionally, I'd like to know if the e-Value should be abs(e-Value)? Because it can be negative. ...
written 9.3 years ago by Beeth170
12
votes
1
answer
5.5k
views
1
answer
E-Value In Blast
... Hi all: I am calculating my e-Value for my own BLAST alignment. I used the formulae: e= mn2^-S' where: m = length of the query sequence n = total number of lengths of all template sequences in the template file S' = bit score. I was wondering about parameter n: Do I need to sum all lengths of t ...
blast written 9.3 years ago by Beeth170 • updated 9.3 years ago by Qdjm1.9k
10
votes
2
answers
1.6k
views
2
answers
Is A Gap At The Same Position In Query And Template Possible?
... Hi: I was wondering if a gap at the same position in query and template sequence is possible. Is that from a biological point of view possible or not? As example: ACTCC--CT ACTCCC--G Thanks Beeth ...
blast written 9.3 years ago by Beeth170 • updated 9.3 years ago by Lyco2.3k
8
votes
1
answer
8.7k
views
1
answer
Raw Alignment Score Calculation
... Thanks for lots of answers and I've started with lots of sources here. It helps me to get a good introduction to blast. After I've now a little more understanding I can ask more specific questions such as the following: The following blast result: ATTTGCAGAATTTGCAAAAAAATGTTTGT ||||||||||||||| ...
scoring blast written 9.3 years ago by Beeth170 • updated 9.3 years ago by Gww2.7k
0
votes
4
answers
17k
views
4
answers
Answer: A: How Is The Score And E-Value Calculated In Blast Outputs
... Thanks for lots of answers and I've started with lots of sources here. It helps me to get a good introduction to blast. After I've now a little more understanding I can ask more specific questions such as the following: The following blast result: ATTTGCAGAATTTGCAAAAAAATGTTTGT ||||||||||||||| ||| ...
written 9.3 years ago by Beeth170
19
votes
4
answers
17k
views
8 follow
4
answers
How Is The Score And E-Value Calculated In Blast Outputs
... Hi! I am working on a BLAST similar tool and wanted to implement the Score (raw Alignment score) and the E-value. I was wondering if someone could please explain me how it is calculated by showing it with an example. I found lots of explanations but didn't get the right answers. I really need an ex ...
scoring blast written 9.4 years ago by Beeth170
0
votes
8
answers
8.6k
views
8
answers
Comment: C: Any Local Gui-Guided Blast Tools?
... thank you very much! I'll have a look on that too! ...
written 9.5 years ago by Beeth170
0
votes
8
answers
8.6k
views
8
answers
Comment: C: Any Local Gui-Guided Blast Tools?
... Thanks, no I haven't looked on that yet! But I am more looking for local blast tools (commercial or non-commercial) as the BlastStation. I've used several times the local blast from NCBI as well as the NCBI toolkit but I'd like to know some attractive alternatives. ...
written 9.5 years ago by Beeth170

Latest awards to Beeth

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1705 users visited in the last hour