User: oliver.bayfield

gravatar for oliver.bayfield
Reputation:
130
Status:
New User
Location:
United States
Last seen:
4 years, 4 months ago
Joined:
4 years, 5 months ago
Email:
o**************@york.ac.uk

Posts by oliver.bayfield

<prev • 39 results • page 1 of 4 • next >
0
votes
0
answers
1.1k
views
0
answers
Batch Glimmer3 annotation for multiple fastas
... I have a fasta nt file containing about 2000 bacterial/archeal entries, and I'd like to use something like glimmer to do the gene calling inside each fasta sequence, each of about 3000nt (I predict 2 or 3 genes each entry). Is there a server that would allow a batch upload and then treat each entry ...
fasta annotation written 4.4 years ago by oliver.bayfield130 • updated 2.8 years ago by Biostar ♦♦ 20
0
votes
3
answers
1.9k
views
3
answers
Answer: A: BLAST options error: tried to set option (130) and value (1), line (537)
... (Re. to above comment) Yes, when I copy something in I correct them all as a matter of course. It seems to be related with output format 11. Output format 6 for instance does at least begin running (although later fails with 'Segmentation fault'?). Thanks ...
written 4.4 years ago by oliver.bayfield130
0
votes
3
answers
1.9k
views
3
answers
Comment: C: BLAST options error: tried to set option (130) and value (1), line (537)
... Unfortunately this doesn't solve it. Usually you get a 'didn't recognise flag' type error when you copy the wrong hyphen in also. ...
written 4.4 years ago by oliver.bayfield130
0
votes
3
answers
1.9k
views
3
answers
BLAST options error: tried to set option (130) and value (1), line (537)
... I'm running local blast/2.2.30+ (on a server), command blastx (-task blastx-fast) against the nr database, with a query file of about 2000 fasta nt sequences of the form:      >12345678:1200-1400_+      ACGTACGTACGTAGCTAGCTAGCTGACTGACTG where the first number refers to genome gi, followed by s ...
fasta local blast blast written 4.4 years ago by oliver.bayfield130 • updated 3.8 years ago by susan.klein50
0
votes
5
answers
1.2k
views
5
answers
Comment: C: What would make fasta file indexing stop prematurely?
... I know. Don't look a gift horse in the mouth eh. ...
written 4.4 years ago by oliver.bayfield130
0
votes
4
answers
4.7k
views
4
answers
Comment: C: Tips to speed up read.fasta() in R for large files?
... Thanks cyril-cros. Indexing looks like the sensible way to go, however how would I now go about incorporating it into my script (below), which other than reading in this large fasta file works fine, where now instead of read.fasta() I'm additionally calling on a .fai file I assume to only read in on ...
written 4.4 years ago by oliver.bayfield130
0
votes
5
answers
1.2k
views
5
answers
Comment: C: What would make fasta file indexing stop prematurely?
... So turns out if I change the commands slightly the .fai file is produced in full, and it doesn't simultaneously cut down my orginal file size to a fraction of what it was: library(Rsamtools) file_path <- "myfile.fa" indexFa(file_path) Previously I was running: library(Rsamtools) indexF ...
written 4.4 years ago by oliver.bayfield130
0
votes
5
answers
1.2k
views
5
answers
Comment: C: What would make fasta file indexing stop prematurely?
... Thanks, I expect memory has held me back at one point here, though I've managed to use Rsamtools indexing by changing my commands slightly (above). +1 ...
written 4.4 years ago by oliver.bayfield130
0
votes
5
answers
1.2k
views
5
answers
Comment: C: What would make fasta file indexing stop prematurely?
... Is that different to the one I'm using above? I don't think it will index which is my current problem ...
written 4.4 years ago by oliver.bayfield130
0
votes
5
answers
1.2k
views
5
answers
Comment: C: What would make fasta file indexing stop prematurely?
... 7Gb ...
written 4.4 years ago by oliver.bayfield130

Latest awards to oliver.bayfield

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1016 users visited in the last hour