Admin: genomax

gravatar for genomax
genomax92k
Reputation:
92,220
Status:
Trusted
Location:
United States
Last seen:
4 minutes ago
Joined:
5 years, 5 months ago
Email:
g*******@gmail.com

Posts by genomax

<prev • 16,428 results • page 1 of 1643 • next >
0
votes
0
answers
13
views
0
answers
Comment: C: Regarding Barley genome
... If you get the [CDS file][1] (and know the ID of the gene you are interested in) you can find the sequence of the gene. Note these don't contain introns or UTR sequences. [1]: ftp://ftp.ensemblgenomes.org/pub/plants/release-48/fasta/hordeum_vulgare/cds/Hordeum_vulgare.IBSC_v2.cds.all.fa.gz ...
written just now by genomax92k
0
votes
0
answers
13
views
0
answers
Comment: C: Regarding Barley genome
... You may want to grab genome sequence from Ensembl. You can find the genome sequence and CDS from this [FTP location][1]. [1]: ftp://ftp.ensemblgenomes.org/pub/plants/release-48/fasta/hordeum_vulgare ...
written 28 minutes ago by genomax92k
1
vote
1
answer
44
views
1
answers
Comment: C: GDC TCGA LUAD dataset iCluster.group parameter
... Please use `ADD COMMENT/ADD REPLY` when responding to existing posts to keep threads logically organized. `SUBMIT ANSWER` is for new answers to original question. ...
written 1 hour ago by genomax92k
1
vote
1
answer
58
views
1
answers
Answer: A: Does the host of human coronaviruses (CoVs) genomes/sequences must be from human
... Original SARS-CoV (not SARS-CoV-2, current virus that is causing the pandemic) virus originated in Bats. So humans are not the normal host for this virus. I am not sure if there are any "human" coronaviruses as in humans are their primary host. There may be but this is not the right forum to ask t ...
written 1 hour ago by genomax92k
0
votes
0
answers
29
views
0
answers
Comment: C: How to download TCGA normal sample ?
... See @Kevin's answer here : https://www.biostars.org/p/318627/#318675 TCGA project was conceived a long time ago when sequencing as still expensive. They decided to maximize the returns by prioritizing tumor samples. You should be able to identify matched normals based on their ID's. In any case yo ...
written 2 hours ago by genomax92k
0
votes
1
answer
15k
views
1
answers
Comment: C: Introducing Clumpify: Create 30% Smaller, Faster Gzipped Fastq Files. And remov
... NextSeq flow cells are particularly large in size so it would likely not be appropriate to use those settings with iSeq. You may want to experiment with HiSeq settings to see if you have a problem with duplicates first. ...
written 17 hours ago by genomax92k
0
votes
0
answers
39
views
0
answers
Comment: C: Alternatives for Staden Package?
... Check on @Michael's suggestion here: https://www.biostars.org/p/374823/#374859 ...
written 23 hours ago by genomax92k
1
vote
1
answer
83
views
1
answers
Comment: C: Changing chromosome names in BAM files
... Look into `samtools reheader` option that can be used for this purpose. @Igor makes a good point above. ...
written 1 day ago by genomax92k
1
vote
1
answer
139
views
1
answers
Comment: C: Is Bioinformatics enough? Is it taken seriously?
... The fact that you are posting to this forum, which is used by thousands across the world, is a testament that bioinformatics (informatics in general) is an important scientific field and is taken seriously by many. It on its own is perhaps not going to solve world's problems but it certainly does fa ...
written 1 day ago by genomax92k
0
votes
0
answers
76
views
0
answers
Comment: C: How to map longer reads against a local reference using Bowtie
... I am not sure what you are doing above in the loop. Since you need to know > how many reads contain each reference I have you need to take one pattern e.g. `CCAGGTAGTAGTACGTCTGTT` and then run it against your fasta files to get the reads that match this pattern. bbduk.sh in=your.fa liter ...
written 1 day ago by genomax92k

Latest awards to genomax

Commentator 14 days ago, created a comment with at least 3 up-votes. For C: Google genomics cloud platform ?
Scholar 16 days ago, created an answer that has been accepted. For A: Error: No Space left on device
Teacher 19 days ago, created an answer with at least 3 up-votes. For A: Linearize fasta files
Scholar 19 days ago, created an answer that has been accepted. For A: Error: No Space left on device
Scholar 21 days ago, created an answer that has been accepted. For A: Error: No Space left on device
Teacher 25 days ago, created an answer with at least 3 up-votes. For A: Linearize fasta files
Scholar 25 days ago, created an answer that has been accepted. For A: Error: No Space left on device
Teacher 27 days ago, created an answer with at least 3 up-votes. For A: Linearize fasta files
Scholar 27 days ago, created an answer that has been accepted. For A: Error: No Space left on device
Scholar 27 days ago, created an answer that has been accepted. For A: Error: No Space left on device
Teacher 28 days ago, created an answer with at least 3 up-votes. For A: Linearize fasta files
Scholar 28 days ago, created an answer that has been accepted. For A: Error: No Space left on device
Scholar 5 weeks ago, created an answer that has been accepted. For A: Error: No Space left on device
Teacher 5 weeks ago, created an answer with at least 3 up-votes. For A: Linearize fasta files
Scholar 5 weeks ago, created an answer that has been accepted. For A: Error: No Space left on device
Teacher 5 weeks ago, created an answer with at least 3 up-votes. For A: Linearize fasta files
Scholar 5 weeks ago, created an answer that has been accepted. For A: Error: No Space left on device
Scholar 5 weeks ago, created an answer that has been accepted. For A: Error: No Space left on device
Commentator 6 weeks ago, created a comment with at least 3 up-votes. For C: Google genomics cloud platform ?
Scholar 6 weeks ago, created an answer that has been accepted. For A: Trimmomatic job script to run on multiple pair end read file
Scholar 7 weeks ago, created an answer that has been accepted. For A: Trimmomatic job script to run on multiple pair end read file
Teacher 8 weeks ago, created an answer with at least 3 up-votes. For A: Linearize fasta files
Appreciated 8 weeks ago, created a post with more than 5 votes. For C: Corona Virus- Sequence alignment-Phylogeny analysis
Commentator 8 weeks ago, created a comment with at least 3 up-votes. For C: Google genomics cloud platform ?
Teacher 8 weeks ago, created an answer with at least 3 up-votes. For A: Trimmomatic job script to run on multiple pair end read file

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2173 users visited in the last hour