User: ashkan

gravatar for ashkan
ashkan110
Reputation:
110
Status:
Trusted
Location:
Last seen:
3 months ago
Joined:
5 years ago
Email:
b**************@gmail.com

Posts by ashkan

<prev • 56 results • page 1 of 6 • next >
0
votes
0
answers
1.2k
views
0
answers
Comment: C: read count normalization for spike
... do you think one is enough? I am planning to use edgeR. what do you think? is that fine? ...
written 3.3 years ago by ashkan110
15
votes
1
answer
10k
views
10 follow
1
answer
finding adapters from fastq file
... I have some fastq files from Ribo-seq data but don't know the adapters when processing files. do you know how I can get the adapter sequence from fastq files? ...
rna-seq written 3.4 years ago by ashkan110 • updated 3.4 years ago by reza.jabal370
2
votes
1
answer
682
views
1
answer
grouping the genes based on the length of coding sequence
... I have a list of genes with coding sequence length. I want to group them into 10 groups. do you know what the best way is to do so? ...
sequencing written 3.4 years ago by ashkan110 • updated 3.4 years ago by Pierre Lindenbaum129k
7
votes
2
answers
1.6k
views
5 follow
2
answers
how to score the values in a dictionary in python
... I have a dictionary like this small example: raw = {'id1': ['KKKKKK', 'MMMMMMMMMMMMMMM'], 'id2': ['KKKKKM', 'KKKKKK']} as you see the values are are list. I would like to replace the list with a number which is score. I score each character in the list based on their length. if the length is 6 ...
sequence written 3.6 years ago by ashkan110 • updated 3.6 years ago by a.zielezinski9.2k
1
vote
1
answer
1.3k
views
1
answer
the most frequent isoform of each gene specific to the cell line
... how can I find the most frequent isoform in each cell line. for example I have RNA-seq data of HeLa cells and want to get only one isoform(transcript) per gene but the one which is specific to HeLa cells for example. ...
rna-seq written 3.6 years ago by ashkan110
0
votes
0
answers
1.0k
views
0
answers
problem with filtering "Sequence unavailable"
... I have a file like the small example: small example: >ENSG00000004142|ENST00000003607|POLDIP2|||2118 Sequence unavailable >ENSG00000003056|ENST00000000412|M6PR|9099001;9102084|9099001;9102551|2756 CCAGGTTGTTTGCCTCTGGTCGGAAAGGGAAACTACCCCTGCTTCCACTCTGACAGCAGA but I have too man ...
sequence written 3.6 years ago by ashkan110 • updated 3.6 years ago by RamRS27k
0
votes
0
answers
2.0k
views
0
answers
filtering some sequences from txt file in python
... I have too many lines like this: >ENSG00000100206|ENST00000216024|DMC1|2371|38568257;38570043|38568289;38570286 CTCAGACGTCGGGCCGACGCAAGGCCACGCGCGCGAACACACAGGTGCGGCCCCGGGCCA CACGCACACCGTACAC >ENSG00000001630|ENST00000003100|CYP51A1|3210|92134365|92134530 TATATCACAGTTTCTTTCT ...
sequence written 3.6 years ago by ashkan110
7
votes
2
answers
2.3k
views
7 follow
2
answers
extracting 5'UTR of each gene
... I have RNA-seq data and aligned them. I am looking for a way to get only 5'UTR of each gene and look for a motif. do you guys know how to get the 5'UTR? ...
rna-seq written 3.6 years ago by ashkan110 • updated 3.6 years ago by Ron990
2
votes
0
answers
890
views
0
answers
optimum statistical test to get significance level
... I have 4 samples and got RNA-seq data from all 4 samples and count the read count for all of them. then I got the genes involved in cell cycle and got the read counts only for those genes. then to compare samples 1 and 2 I divided the read count per gene from sample 2 by that of sample one. I did th ...
rna-seq written 3.6 years ago by ashkan110 • updated 3.5 years ago by Biostar ♦♦ 20
0
votes
3
answers
798
views
6 follow
3
answers
(Closed) sending big files to other countries
... I am trying to send 10 fastq files (almost 20 GB) from Sweden to the UK. do you guys know any way to send my files? I don't have commercial dropbox ...
gene written 3.6 years ago by ashkan110 • updated 3.6 years ago by Tonor420

Latest awards to ashkan

Great Question 3.3 years ago, created a question with more than 5,000 views. For finding adapters from fastq file
Popular Question 3.3 years ago, created a question with more than 1,000 views. For cloud based vs local pipeline for RNA-seq data analysis
Popular Question 3.3 years ago, created a question with more than 1,000 views. For uploading files to the UCSC
Popular Question 3.3 years ago, created a question with more than 1,000 views. For BED to BigBed conversion problem.
Popular Question 3.3 years ago, created a question with more than 1,000 views. For differentially expression analysis using raw read counts
Popular Question 3.3 years ago, created a question with more than 1,000 views. For statistical analysis of RNA-seq data
Popular Question 3.3 years ago, created a question with more than 1,000 views. For problem with counting reads per gene using HTseq
Popular Question 3.3 years ago, created a question with more than 1,000 views. For extracting 5'UTR of each gene
Popular Question 3.3 years ago, created a question with more than 1,000 views. For upload Multiple custom tracks on ucsc
Popular Question 3.3 years ago, created a question with more than 1,000 views. For correction for multiple testing
Popular Question 3.3 years ago, created a question with more than 1,000 views. For the most frequent isoform of each gene specific to the cell line
Popular Question 3.3 years ago, created a question with more than 1,000 views. For finding adapters from fastq file
Popular Question 3.3 years ago, created a question with more than 1,000 views. For Ribo-seq vs RNA-seq read count
Popular Question 3.3 years ago, created a question with more than 1,000 views. For loading data file into GSEA
Popular Question 3.3 years ago, created a question with more than 1,000 views. For exporting the results of edgeR into a text file using R
Popular Question 3.3 years ago, created a question with more than 1,000 views. For CDS read counts per gene
Popular Question 3.3 years ago, created a question with more than 1,000 views. For error in uploading bigbed file on UCSC
Popular Question 3.3 years ago, created a question with more than 1,000 views. For filtering the rows in R
Popular Question 3.3 years ago, created a question with more than 1,000 views. For how to score the values in a dictionary in python
Popular Question 3.3 years ago, created a question with more than 1,000 views. For the difference between human and mouse wiggle files for uploading on UCSC
Popular Question 3.3 years ago, created a question with more than 1,000 views. For filtering out the genes in RNA-seq experiment
Popular Question 3.3 years ago, created a question with more than 1,000 views. For how to modify one column in text file in python - solved
Popular Question 3.3 years ago, created a question with more than 1,000 views. For error in removing some lines in bam file
Popular Question 3.3 years ago, created a question with more than 1,000 views. For problem with uploading wiggle files to UCSC
Popular Question 3.3 years ago, created a question with more than 1,000 views. For filtering some sequences from txt file in python

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 995 users visited in the last hour