User: eric.kern13

gravatar for eric.kern13
eric.kern1390
Reputation:
90
Status:
Trusted
Location:
United States
Last seen:
3 weeks, 2 days ago
Joined:
2 years, 3 months ago
Email:
e**********@gmail.com

Posts by eric.kern13

<prev • 34 results • page 1 of 4 • next >
0
votes
1
answer
1.4k
views
1
answers
Comment: C: Question about dbSNP rs #s
... Do you know of an easy way to update rsid's that have been retired? ...
written 23 days ago by eric.kern1390
0
votes
1
answer
12k
views
1
answers
Comment: C: Duplicated Reads In Rna-Seq Experiment
... (I would like to hear the answer to this as well.) ...
written 3 months ago by eric.kern1390
0
votes
5
answers
21k
views
5
answers
Comment: C: Should We Remove Duplicated Reads In Rna-Seq ?
... This is an interesting comment and I'd like to understand it better. Are you using the word "regularization" in the statistical sense, for example as in "Tikhonov regularization"? If so, can you describe the statistical methods you have in mind? Also, how do you know that there are more duplicates p ...
written 3 months ago by eric.kern1390
0
votes
1
answer
189
views
1
answer
What happens during seed stitching when STAR initially gets the wrong MMP?
... Suppose I have the following read: AAGGAAGGAAGGAAGGACTTCCTT I want to align it to one of these two reference sequences: AAGGAAGGAAGGAAGGACAAGGAA AAGGAAGGAAGGAAGGCCTTCCTT Clearly, the second reference sequence is where the read belongs: there's only one mismatch. The maximum mappable ...
star rna-seq written 5 months ago by eric.kern1390 • updated 5 months ago by Santosh Anand3.0k
0
votes
1
answer
258
views
1
answers
Comment: C: Retrieve all genes under a mammalian phenotype ontology term
... Works like a charm. Thank you very much! ...
written 6 months ago by eric.kern1390
0
votes
1
answer
258
views
1
answers
Comment: C: Retrieve all genes under a mammalian phenotype ontology term
... I tried to; it didn't work. I'll try again. ...
written 6 months ago by eric.kern1390
2
votes
1
answer
258
views
1
answer
Retrieve all genes under a mammalian phenotype ontology term
... I want to retrieve all genes corresponding to a given mammalian phenotype ontology term (for example, MP:0005375), preferably within R. Are there tools to do this? Can I do it within BioMart? Or is the best bet to build something around the APIs [here][1] or [here][2]? Related: [similar question fo ...
R biomart go mammalian phenotype ontology written 6 months ago by eric.kern1390 • updated 6 months ago by Mike Smith330
0
votes
1
answer
781
views
1
answers
Comment: C: cell surface receptor genes
... Thanks for this list of resources! ...
written 13 months ago by eric.kern1390
1
vote
1
answer
559
views
1
answers
Answer: A: Interpreting ANNOVAR allele frequency output
... Below, I quote a response from Kai Wang, ANNOVAR creator/maintainer: > you should just use table_annovar.pl to print out allele frequency for > all variants in your input. The word "minor allele frequency" cannot > be defined well, because rare allele in one population will be common > ...
written 13 months ago by eric.kern1390
1
vote
1
answer
559
views
1
answer
Interpreting ANNOVAR allele frequency output
... Hi Biostars, I'm using ANNOVAR to annotate some WGS data. I want to pare down the list until I am left with variants of very low frequency. I've got ANNOVAR working, but I'd appreciate your help interpreting its output. Here's what I did. To split out the rare variants, I issued this command (or r ...
genome sequencing written 13 months ago by eric.kern1390

Latest awards to eric.kern13

Supporter 23 days ago, voted at least 25 times.
Popular Question 13 months ago, created a question with more than 1,000 views. For Pysam cannot find index
Scholar 13 months ago, created an answer that has been accepted. For A: Looking for experience
Scholar 2.3 years ago, created an answer that has been accepted. For A: Looking for experience
Teacher 2.3 years ago, created an answer with at least 3 up-votes. For A: Looking for experience

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 797 users visited in the last hour