User: eric.kern13

gravatar for eric.kern13
eric.kern1390
Reputation:
90
Status:
Trusted
Location:
United States
Last seen:
1 week, 1 day ago
Joined:
1 year, 11 months ago
Email:
e**********@gmail.com

Posts by eric.kern13

<prev • 31 results • page 1 of 4 • next >
0
votes
1
answer
98
views
1
answer
What happens during seed stitching when STAR initially gets the wrong MMP?
... Suppose I have the following read: AAGGAAGGAAGGAAGGACTTCCTT I want to align it to one of these two reference sequences: AAGGAAGGAAGGAAGGACAAGGAA AAGGAAGGAAGGAAGGCCTTCCTT Clearly, the second reference sequence is where the read belongs: there's only one mismatch. The maximum mappable ...
star rna-seq written 7 weeks ago by eric.kern1390 • updated 7 weeks ago by Santosh Anand2.7k
0
votes
1
answer
168
views
1
answers
Comment: C: Retrieve all genes under a mammalian phenotype ontology term
... Works like a charm. Thank you very much! ...
written 11 weeks ago by eric.kern1390
0
votes
1
answer
168
views
1
answers
Comment: C: Retrieve all genes under a mammalian phenotype ontology term
... I tried to; it didn't work. I'll try again. ...
written 11 weeks ago by eric.kern1390
2
votes
1
answer
168
views
1
answer
Retrieve all genes under a mammalian phenotype ontology term
... I want to retrieve all genes corresponding to a given mammalian phenotype ontology term (for example, MP:0005375), preferably within R. Are there tools to do this? Can I do it within BioMart? Or is the best bet to build something around the APIs [here][1] or [here][2]? Related: [similar question fo ...
R biomart go mammalian phenotype ontology written 11 weeks ago by eric.kern1390 • updated 11 weeks ago by Mike Smith200
0
votes
1
answer
624
views
1
answers
Comment: C: cell surface receptor genes
... Thanks for this list of resources! ...
written 9 months ago by eric.kern1390
1
vote
1
answer
429
views
1
answers
Answer: A: Interpreting ANNOVAR allele frequency output
... Below, I quote a response from Kai Wang, ANNOVAR creator/maintainer: > you should just use table_annovar.pl to print out allele frequency for > all variants in your input. The word "minor allele frequency" cannot > be defined well, because rare allele in one population will be common > ...
written 9 months ago by eric.kern1390
1
vote
1
answer
429
views
1
answer
Interpreting ANNOVAR allele frequency output
... Hi Biostars, I'm using ANNOVAR to annotate some WGS data. I want to pare down the list until I am left with variants of very low frequency. I've got ANNOVAR working, but I'd appreciate your help interpreting its output. Here's what I did. To split out the rare variants, I issued this command (or r ...
genome sequencing written 9 months ago by eric.kern1390
0
votes
0
answers
494
views
0
answers
Comment: C: EdgeR or Ttest/ANOVA for non normal RNAseq data?
... How many rows of data do you have? Linear models such as ANOVA rely heavily on independence of errors and constant variability, but with enough data, normality is not as crucial. ...
written 15 months ago by eric.kern1390
0
votes
1
answer
569
views
1
answers
Comment: C: Can someone help me with imputation of missing SNPs using beagle 4?
... Did you check the locus it mentions ( 5:35101444 ) to see if there's anything wrong in the data? ...
written 15 months ago by eric.kern1390
0
votes
1
answer
724
views
1
answers
Answer: A: Comparing results from ADMIXTURE and EIGENSTRAT
... First, a couple of things that may have gone wrong: - There is no natural association between the first eigenvector and the first person, the second eigenvector and the second person, etc.  - Why does that comment say eigvals if you're talking about the individuals' eigenvectors? Now my answer. In ...
written 21 months ago by eric.kern1390

Latest awards to eric.kern13

Popular Question 9 months ago, created a question with more than 1,000 views. For Pysam cannot find index
Scholar 9 months ago, created an answer that has been accepted. For A: Looking for experience
Scholar 23 months ago, created an answer that has been accepted. For A: Looking for experience
Teacher 23 months ago, created an answer with at least 3 up-votes. For A: Looking for experience

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 952 users visited in the last hour