User: eric.kern13

gravatar for eric.kern13
eric.kern13130
Reputation:
130
Status:
Trusted
Location:
United States
Last seen:
1 month, 1 week ago
Joined:
3 years, 6 months ago
Email:
e**********@gmail.com

Posts by eric.kern13

<prev • 38 results • page 1 of 4 • next >
0
votes
1
answer
247
views
1
answers
Comment: C: Help setting up lncRNA-screen from github
... Did you ever get this working? I am interested to compare notes regarding the format of the resulting BED file. ...
written 6 weeks ago by eric.kern13130
1
vote
4
answers
26k
views
4
answers
Comment: C: How To Write Data In A Granges Object To A Bed File.
... Your link currently gives this thread as the first hit. Profit indeed. ...
written 3 months ago by eric.kern13130
0
votes
4
answers
4.7k
views
4
answers
Answer: A: Adapter/Linker/Primer Sequence Database?
... Using the ncbi UNIVEC reference or similar, you can do a BLAST search against common artificial sequences. https://www.ncbi.nlm.nih.gov/tools/vecscreen/univec/ ...
written 6 months ago by eric.kern13130
1
vote
1
answer
679
views
1
answers
Answer: A: Overdispersion for single cell RNA seq experiments
... What have you tried so far? One sensible solution might be to try: - whatever you would try if you didn't have to worry about low counts; maybe K-means - some out-of-the-box method such as PAGODA. http://hms-dbmi.github.io/scde/pagoda.html If those don't get you to where you need to be, then where ...
written 12 months ago by eric.kern13130
0
votes
1
answer
1.8k
views
1
answers
Comment: C: Question about dbSNP rs #s
... Do you know of an easy way to update rsid's that have been retired? ...
written 15 months ago by eric.kern13130
0
votes
1
answer
15k
views
1
answers
Comment: C: Duplicated Reads In Rna-Seq Experiment
... (I would like to hear the answer to this as well.) ...
written 18 months ago by eric.kern13130
0
votes
5
answers
27k
views
5
answers
Comment: C: Should We Remove Duplicated Reads In Rna-Seq ?
... This is an interesting comment and I'd like to understand it better. Are you using the word "regularization" in the statistical sense, for example as in "Tikhonov regularization"? If so, can you describe the statistical methods you have in mind? Also, how do you know that there are more duplicates p ...
written 18 months ago by eric.kern13130
0
votes
1
answer
612
views
1
answer
What happens during seed stitching when STAR initially gets the wrong MMP?
... Suppose I have the following read: AAGGAAGGAAGGAAGGACTTCCTT I want to align it to one of these two reference sequences: AAGGAAGGAAGGAAGGACAAGGAA AAGGAAGGAAGGAAGGCCTTCCTT Clearly, the second reference sequence is where the read belongs: there's only one mismatch. The maximum mappable ...
star rna-seq written 20 months ago by eric.kern13130 • updated 20 months ago by Santosh Anand4.6k
0
votes
1
answer
724
views
1
answers
Comment: C: Retrieve all genes under a mammalian phenotype ontology term
... Works like a charm. Thank you very much! ...
written 21 months ago by eric.kern13130
0
votes
1
answer
724
views
1
answers
Comment: C: Retrieve all genes under a mammalian phenotype ontology term
... I tried to; it didn't work. I'll try again. ...
written 21 months ago by eric.kern13130

Latest awards to eric.kern13

Popular Question 6 months ago, created a question with more than 1,000 views. For 1000 genomes technical data: match exon capture probes to samples
Popular Question 6 months ago, created a question with more than 1,000 views. For Read depths from 1000G exome sequencing are almost all zero.
Popular Question 6 months ago, created a question with more than 1,000 views. For Mappability Scores from bigWigAverageOverBed all zero
Popular Question 10 months ago, created a question with more than 1,000 views. For +/- strand conventions for probe sequences
Popular Question 12 months ago, created a question with more than 1,000 views. For Pysam cannot find index
Supporter 15 months ago, voted at least 25 times.
Popular Question 2.3 years ago, created a question with more than 1,000 views. For Pysam cannot find index
Scholar 2.4 years ago, created an answer that has been accepted. For A: Looking for experience
Scholar 3.5 years ago, created an answer that has been accepted. For A: Looking for experience
Teacher 3.5 years ago, created an answer with at least 3 up-votes. For A: Looking for experience

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1911 users visited in the last hour