User: eric.kern13

gravatar for eric.kern13
eric.kern1390
Reputation:
90
Status:
Trusted
Location:
United States
Last seen:
1 month, 1 week ago
Joined:
2 years, 1 month ago
Email:
e**********@gmail.com

Posts by eric.kern13

<prev • 33 results • page 1 of 4 • next >
0
votes
1
answer
12k
views
1
answers
Comment: C: Duplicated Reads In Rna-Seq Experiment
... (I would like to hear the answer to this as well.) ...
written 7 weeks ago by eric.kern1390
0
votes
5
answers
20k
views
5
answers
Comment: C: Should We Remove Duplicated Reads In Rna-Seq ?
... This is an interesting comment and I'd like to understand it better. Are you using the word "regularization" in the statistical sense, for example as in "Tikhonov regularization"? If so, can you describe the statistical methods you have in mind? Also, how do you know that there are more duplicates p ...
written 7 weeks ago by eric.kern1390
0
votes
1
answer
147
views
1
answer
What happens during seed stitching when STAR initially gets the wrong MMP?
... Suppose I have the following read: AAGGAAGGAAGGAAGGACTTCCTT I want to align it to one of these two reference sequences: AAGGAAGGAAGGAAGGACAAGGAA AAGGAAGGAAGGAAGGCCTTCCTT Clearly, the second reference sequence is where the read belongs: there's only one mismatch. The maximum mappable ...
star rna-seq written 3 months ago by eric.kern1390 • updated 3 months ago by Santosh Anand2.9k
0
votes
1
answer
217
views
1
answers
Comment: C: Retrieve all genes under a mammalian phenotype ontology term
... Works like a charm. Thank you very much! ...
written 4 months ago by eric.kern1390
0
votes
1
answer
217
views
1
answers
Comment: C: Retrieve all genes under a mammalian phenotype ontology term
... I tried to; it didn't work. I'll try again. ...
written 4 months ago by eric.kern1390
2
votes
1
answer
217
views
1
answer
Retrieve all genes under a mammalian phenotype ontology term
... I want to retrieve all genes corresponding to a given mammalian phenotype ontology term (for example, MP:0005375), preferably within R. Are there tools to do this? Can I do it within BioMart? Or is the best bet to build something around the APIs [here][1] or [here][2]? Related: [similar question fo ...
R biomart go mammalian phenotype ontology written 4 months ago by eric.kern1390 • updated 4 months ago by Mike Smith250
0
votes
1
answer
698
views
1
answers
Comment: C: cell surface receptor genes
... Thanks for this list of resources! ...
written 11 months ago by eric.kern1390
1
vote
1
answer
488
views
1
answers
Answer: A: Interpreting ANNOVAR allele frequency output
... Below, I quote a response from Kai Wang, ANNOVAR creator/maintainer: > you should just use table_annovar.pl to print out allele frequency for > all variants in your input. The word "minor allele frequency" cannot > be defined well, because rare allele in one population will be common > ...
written 11 months ago by eric.kern1390
1
vote
1
answer
488
views
1
answer
Interpreting ANNOVAR allele frequency output
... Hi Biostars, I'm using ANNOVAR to annotate some WGS data. I want to pare down the list until I am left with variants of very low frequency. I've got ANNOVAR working, but I'd appreciate your help interpreting its output. Here's what I did. To split out the rare variants, I issued this command (or r ...
genome sequencing written 11 months ago by eric.kern1390
0
votes
0
answers
530
views
0
answers
Comment: C: EdgeR or Ttest/ANOVA for non normal RNAseq data?
... How many rows of data do you have? Linear models such as ANOVA rely heavily on independence of errors and constant variability, but with enough data, normality is not as crucial. ...
written 17 months ago by eric.kern1390

Latest awards to eric.kern13

Popular Question 11 months ago, created a question with more than 1,000 views. For Pysam cannot find index
Scholar 11 months ago, created an answer that has been accepted. For A: Looking for experience
Scholar 2.1 years ago, created an answer that has been accepted. For A: Looking for experience
Teacher 2.1 years ago, created an answer with at least 3 up-votes. For A: Looking for experience

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1864 users visited in the last hour