User: Zhshqzyc

gravatar for Zhshqzyc
Zhshqzyc450
Reputation:
450
Status:
New User
Location:
Last seen:
6 years, 9 months ago
Joined:
7 years, 3 months ago
Email:
z*******@yahoo.com

Posts by Zhshqzyc

<prev • 69 results • page 1 of 7 • next >
0
votes
2
answers
4.3k
views
2
answers
Comment: C: Found Invalid Nucleotide Sequence
... sorry, my fault ...
written 6.8 years ago by Zhshqzyc450
0
votes
2
answers
4.3k
views
2
answers
Comment: C: Found Invalid Nucleotide Sequence
... NameError: name 'sys' is not defined ...
written 6.8 years ago by Zhshqzyc450
0
votes
2
answers
2.5k
views
2
answers
Comment: C: How To Pull Out Qual From Multi Line Fastq?
... No, it is 37.8GB. Could you please double check your code? ...
written 6.8 years ago by Zhshqzyc450
0
votes
2
answers
2.5k
views
2
answers
Comment: C: How To Pull Out Qual From Multi Line Fastq?
... My fastq file is 6GB, I got the quals file is more than 12GB. Is it right? ...
written 6.8 years ago by Zhshqzyc450
4
votes
2
answers
2.5k
views
7 follow
2
answers
How To Pull Out Qual From Multi Line Fastq?
... From http://biostar.stackexchange.com/questions/1389/how-to-generate-a-consensus-fasta-sequence-from-sam-tools-pileup We use awk and perl to get fasta by awk '/^@chr1$/,/^+$/' consensus.fastq | perl -pe "s/@/>/ ; s/\\+//" > chr1.fasta The sample data @chr1 nnnnnnnagatagaaataCACGATGCGAGCAA ...
fastq quality written 6.8 years ago by Zhshqzyc450 • updated 6.8 years ago by Haluk170
0
votes
2
answers
2.7k
views
2
answers
Comment: C: To Avoid The 'Argument "F" Isn'T Numeric In Numeric
... I tried the command samtools mpileup -uf hg18.fa -g my.bam | bcftools view -cg - | vcfutils.pl vcf2fq > cns.fq But it still failed. Can you list your command? ...
written 6.9 years ago by Zhshqzyc450
1
vote
2
answers
2.7k
views
2
answers
To Avoid The 'Argument "F" Isn'T Numeric In Numeric
... Hello, I am running the command like: samtools mpileup -uf hg18.fa my.bam | bcftools view -cg - | vcfutils.pl vcf2fq > cns.fq However I got many many warnings on the screen which are like Argument "chr1^I22217285^I.^IT^I.^I28.2^I.^IDP=1;;CI95=1.5,0;FQ=-3..." isn't numeric in numeric lt (<) ...
perl samtools written 6.9 years ago by Zhshqzyc450 • updated 6.9 years ago by Swbarnes21.4k
0
votes
1
answer
3.0k
views
1
answers
Comment: C: About The 10Th Column Of The Output Sequence From Samtools View Command
... I still don't understand it. I want to write C# code to extract the sequence by "FLAG" and start position from the output file. Suppose a region is given, can I use substring method in c#/java from 1113 14430092 CCTCGCGGGACTGGTATGGGGACGGTCATGCAATCTGGACAA Such as string s = CCTCGCGGGACTGGTATGGGGACG ...
written 6.9 years ago by Zhshqzyc450
0
votes
1
answer
3.0k
views
1
answers
Comment: C: About The 10Th Column Of The Output Sequence From Samtools View Command
... But it is from gh18/hg19 reference, my bam file is from a patient. Can I get the sequence from the patient based on my output file? Maybe it is a wrong question because my ignorance of genome area? ...
written 6.9 years ago by Zhshqzyc450
0
votes
1
answer
3.0k
views
1
answers
Comment: C: About The 10Th Column Of The Output Sequence From Samtools View Command
... Sorry, it was a mistakenly hit. I supposed to hit up-vote. But my brain is not working well today. I will correct it. So can you get the real sequence within the region? Any language is fine. ...
written 6.9 years ago by Zhshqzyc450

Latest awards to Zhshqzyc

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 826 users visited in the last hour