User: prakash

gravatar for prakash
prakash100
Reputation:
100
Status:
Trusted
Location:
Last seen:
4 days, 21 hours ago
Joined:
2 years, 8 months ago
Email:
j********@gmail.com

Posts by prakash

<prev • 33 results • page 1 of 4 • next >
0
votes
2
answers
151
views
2
answers
Answer: A: The chip-seq binding sites of POLR2B indicate the PoII pause there
... During transcription, pol II elongates over gene body. When you perform ChIPseq, you will find pol II density over promoter as well as gene body. The ratio of pol II enrichment at promoter and gene body determines whether gene is transcribed or not. ...
written 4 weeks ago by prakash100
0
votes
0
answers
186
views
0
answers
RNAseq and ChIPseq integration
... Hi all, I have two replicates of RNAseq data for four different condition (one unstimulated and three different stimulation) with and without a transcription factor(TF) Knock down and ChIPseq data of this factor in all these four condition. I would like to study the effect of stimulation, knock-do ...
chip-seq rna-seq written 9 weeks ago by prakash100
0
votes
3
answers
234
views
3
answers
Comment: C: how to subset sequences based on IDs, but order shall remain preserved?
... The above script should work for input file provided below: Fasta_file >EG01 AATTCAGAAAAGTGCCATAAAACAGGCAAATATAGCACCTATCTTCGATTCCCGATTGAGAAAGCTCGAATCATTAAGAA GATGTAGGTTGGGTTGAGGAACGAGACCCAGCAATTCGATTCCATGTTGGATTAAACAATATCAACCAAGAGTTTGATGT >EG02 CAGGATAACTCCAATTTTTCTTTTAGA ...
written 11 weeks ago by prakash100
0
votes
3
answers
234
views
3
answers
Comment: C: how to subset sequences based on IDs, but order shall remain preserved?
... I think your Id file contains sequence id as >abc , >jkl. So accordingly i have edited the script. If that is the case , then the script should give intended result. ...
written 11 weeks ago by prakash100
0
votes
0
answers
134
views
0
answers
Comment: C: Cufflinks analysis for transcriptome assembly
... Go ahead with the cufflinks pipeline.. use Cuffmerge ...
written 11 weeks ago by prakash100
0
votes
3
answers
234
views
3
answers
Comment: C: how to subset sequences based on IDs, but order shall remain preserved?
... I have edited the script, I hope its working fine now ...
written 11 weeks ago by prakash100
0
votes
3
answers
234
views
3
answers
Comment: C: how to subset sequences based on IDs, but order shall remain preserved?
... can you please provide few example of Id ? ...
written 11 weeks ago by prakash100
0
votes
3
answers
234
views
3
answers
Comment: C: how to subset sequences based on IDs, but order shall remain preserved?
... If I am not wrong you need fasta sequence for selected Id ? right? ...
written 11 weeks ago by prakash100
0
votes
3
answers
234
views
3
answers
Answer: A: how to subset sequences based on IDs, but order shall remain preserved?
... I hope this perl script will solve your purpose Usage : perl script.pl Id_file file.fasta Output.fasta #!/usr/bin/perl @file1 = `cat $ARGV[0]`; @file2 = `cat $ARGV[1]`; %hash; $id ; foreach $fasta(@file2){ chomp($fasta); if($fasta =~ '>'){ ...
written 11 weeks ago by prakash100
0
votes
2
answers
234
views
2
answers
Answer: A: What is my total number of genes in a hypergeometic distribution test?
... Have you tried [BETA cistrome][1] [1]: http://cistrome.org/BETA/ ...
written 3 months ago by prakash100

Latest awards to prakash

Scholar 6 months ago, created an answer that has been accepted. For A: Gene Set Enrichment Analysis after DESeq2
Teacher 6 months ago, created an answer with at least 3 up-votes. For A: Gene Set Enrichment Analysis after DESeq2
Popular Question 6 months ago, created a question with more than 1,000 views. For how to get p value for a set of fdr value
Popular Question 8 months ago, created a question with more than 1,000 views. For how to get p value for a set of fdr value

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 730 users visited in the last hour