User: prakash

gravatar for prakash
prakash120
Reputation:
120
Status:
Trusted
Location:
Last seen:
2 days ago
Joined:
2 years, 10 months ago
Email:
j********@gmail.com

Posts by prakash

<prev • 36 results • page 1 of 4 • next >
1
vote
3
answers
226
views
3
answers
Answer: A: duplicate 'row.names' are not allowed
... If you still want to use first column as rownames , use Check.name= FALSE ...
written 2 days ago by prakash120
0
votes
2
answers
76
views
2
answers
Answer: A: Picard MarkDuplicates flag vs remove issue
... This issue has been discussed earlier.. this may help [https://www.biostars.org/p/267754/#267929][1] [1]: https://www.biostars.org/p/267754/#267929 ...
written 3 days ago by prakash120
1
vote
2
answers
75
views
2
answers
Answer: A: HOMER annotatePeaks.pl 'Unique Peak ID' in first column changed in output file
... I think you need to format the format the peak file and then run annotatePeaks.pl you can follow this link to do the same [https://www.biostars.org/p/278730/#279242][1] [1]: https://www.biostars.org/p/278730/#279242 ...
written 4 days ago by prakash120
0
votes
2
answers
192
views
2
answers
Answer: A: The chip-seq binding sites of POLR2B indicate the PoII pause there
... During transcription, pol II elongates over gene body. When you perform ChIPseq, you will find pol II density over promoter as well as gene body. The ratio of pol II enrichment at promoter and gene body determines whether gene is transcribed or not. ...
written 12 weeks ago by prakash120
0
votes
0
answers
222
views
0
answers
RNAseq and ChIPseq integration
... Hi all, I have two replicates of RNAseq data for four different condition (one unstimulated and three different stimulation) with and without a transcription factor(TF) Knock down and ChIPseq data of this factor in all these four condition. I would like to study the effect of stimulation, knock-do ...
chip-seq rna-seq written 4 months ago by prakash120
0
votes
3
answers
306
views
3
answers
Comment: C: how to subset sequences based on IDs, but order shall remain preserved?
... The above script should work for input file provided below: Fasta_file >EG01 AATTCAGAAAAGTGCCATAAAACAGGCAAATATAGCACCTATCTTCGATTCCCGATTGAGAAAGCTCGAATCATTAAGAA GATGTAGGTTGGGTTGAGGAACGAGACCCAGCAATTCGATTCCATGTTGGATTAAACAATATCAACCAAGAGTTTGATGT >EG02 CAGGATAACTCCAATTTTTCTTTTAGA ...
written 4 months ago by prakash120
0
votes
3
answers
306
views
3
answers
Comment: C: how to subset sequences based on IDs, but order shall remain preserved?
... I think your Id file contains sequence id as >abc , >jkl. So accordingly i have edited the script. If that is the case , then the script should give intended result. ...
written 4 months ago by prakash120
0
votes
0
answers
155
views
0
answers
Comment: C: Cufflinks analysis for transcriptome assembly
... Go ahead with the cufflinks pipeline.. use Cuffmerge ...
written 4 months ago by prakash120
0
votes
3
answers
306
views
3
answers
Comment: C: how to subset sequences based on IDs, but order shall remain preserved?
... I have edited the script, I hope its working fine now ...
written 4 months ago by prakash120
0
votes
3
answers
306
views
3
answers
Comment: C: how to subset sequences based on IDs, but order shall remain preserved?
... can you please provide few example of Id ? ...
written 4 months ago by prakash120

Latest awards to prakash

Scholar 7 months ago, created an answer that has been accepted. For A: Gene Set Enrichment Analysis after DESeq2
Teacher 7 months ago, created an answer with at least 3 up-votes. For A: Gene Set Enrichment Analysis after DESeq2
Popular Question 8 months ago, created a question with more than 1,000 views. For how to get p value for a set of fdr value
Popular Question 10 months ago, created a question with more than 1,000 views. For how to get p value for a set of fdr value

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1067 users visited in the last hour