User: prakash

gravatar for prakash
prakash100
Reputation:
100
Status:
Trusted
Location:
Last seen:
17 hours ago
Joined:
2 years, 6 months ago
Email:
j********@gmail.com

Posts by prakash

<prev • 32 results • page 1 of 4 • next >
0
votes
0
answers
94
views
0
answers
RNAseq and ChIPseq integration
... Hi all, I have two replicates of RNAseq data for four different condition (one unstimulated and three different stimulation) with and without a transcription factor(TF) Knock down and ChIPseq data of this factor in all these four condition. I would like to study the effect of stimulation, knock-do ...
chip-seq rna-seq written 7 days ago by prakash100
0
votes
3
answers
160
views
3
answers
Comment: C: how to subset sequences based on IDs, but order shall remain preserved?
... The above script should work for input file provided below: Fasta_file >EG01 AATTCAGAAAAGTGCCATAAAACAGGCAAATATAGCACCTATCTTCGATTCCCGATTGAGAAAGCTCGAATCATTAAGAA GATGTAGGTTGGGTTGAGGAACGAGACCCAGCAATTCGATTCCATGTTGGATTAAACAATATCAACCAAGAGTTTGATGT >EG02 CAGGATAACTCCAATTTTTCTTTTAGA ...
written 19 days ago by prakash100
0
votes
3
answers
160
views
3
answers
Comment: C: how to subset sequences based on IDs, but order shall remain preserved?
... I think your Id file contains sequence id as >abc , >jkl. So accordingly i have edited the script. If that is the case , then the script should give intended result. ...
written 20 days ago by prakash100
0
votes
0
answers
84
views
0
answers
Comment: C: Cufflinks analysis for transcriptome assembly
... Go ahead with the cufflinks pipeline.. use Cuffmerge ...
written 21 days ago by prakash100
0
votes
3
answers
160
views
3
answers
Comment: C: how to subset sequences based on IDs, but order shall remain preserved?
... I have edited the script, I hope its working fine now ...
written 21 days ago by prakash100
0
votes
3
answers
160
views
3
answers
Comment: C: how to subset sequences based on IDs, but order shall remain preserved?
... can you please provide few example of Id ? ...
written 22 days ago by prakash100
0
votes
3
answers
160
views
3
answers
Comment: C: how to subset sequences based on IDs, but order shall remain preserved?
... If I am not wrong you need fasta sequence for selected Id ? right? ...
written 22 days ago by prakash100
0
votes
3
answers
160
views
3
answers
Answer: A: how to subset sequences based on IDs, but order shall remain preserved?
... I hope this perl script will solve your purpose Usage : perl script.pl Id_file file.fasta Output.fasta #!/usr/bin/perl @file1 = `cat $ARGV[0]`; @file2 = `cat $ARGV[1]`; %hash; $id ; foreach $fasta(@file2){ chomp($fasta); if($fasta =~ '>'){ ...
written 22 days ago by prakash100
0
votes
2
answers
176
views
2
answers
Answer: A: What is my total number of genes in a hypergeometic distribution test?
... Have you tried [BETA cistrome][1] [1]: http://cistrome.org/BETA/ ...
written 6 weeks ago by prakash100
1
vote
4
answers
399
views
4
answers
Answer: A: Doing GSEA analysis on a set of genes
... you can follow the steps provided in this [link][1] [1]: https://www.biostars.org/p/279097/#279127 ...
written 3 months ago by prakash100

Latest awards to prakash

Scholar 4 months ago, created an answer that has been accepted. For A: Gene Set Enrichment Analysis after DESeq2
Teacher 4 months ago, created an answer with at least 3 up-votes. For A: Gene Set Enrichment Analysis after DESeq2
Popular Question 4 months ago, created a question with more than 1,000 views. For how to get p value for a set of fdr value
Popular Question 6 months ago, created a question with more than 1,000 views. For how to get p value for a set of fdr value

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1375 users visited in the last hour