User: Maximilian Haeussler

Last seen:
1 month ago
7 years, 7 months ago

Posts by Maximilian Haeussler

<prev • 104 results • page 1 of 11 • next >
Comment: C: Stranger Things: unexpected limitations of popular tools
... The UCSC bigBed format is something that comes very close: it has only very few defined minimal columns (chrom, start, end, score, strand) and you can add what you want. If the file has a certain structure, it's a PSL (called bigPsl) alignment. It can also be a gene model file when it has certain co ...
written 4 weeks ago by Maximilian Haeussler1.3k
Answer: A: BWASW and _alt alleles
... So the answer seems to be (see comments above): bwa-sw does not support the XA tag. As such, you cannot get the alternative locations for multi-mapping sequences. This makes bwasw quite useless for most real-world applications that I can imagine, tasks that do not involve mapping reads to a genome. ...
written 10 weeks ago by Maximilian Haeussler1.3k
Comment: C: BWASW and _alt alleles
... In this case, my input sequence can be <= 3000 bp.... but you're right, maybe I should use BWA-mem for this? I used bwasw because the input is pretty long, by BWAMEM standards. ...
written 10 weeks ago by Maximilian Haeussler1.3k
Comment: C: BWASW and _alt alleles
... Oh wow, yes, it's indeed there, just not documented under bwasw but bwa backtrack: "Repetitive hits will be randomly chosen." manytThanks!! Well, yeah, I need to know the best match for the input sequence and the _alt match is definitely not a very useful match. I thought that BWA knew better these ...
written 10 weeks ago by Maximilian Haeussler1.3k
BWASW and _alt alleles
... BWA-SW does not find all matches for me, it seems to pick only one random best match. I have no idea how to modify the arguments to have BWA find the secondary matches. Example: temp.fa: >hg38-chr6-test AACACAGGCCGGACAGAAGCTTGGAAGGTCCTGTCTCCCCAGGGAGGAGGCCCCTGGGACAGTGTGGCTCGTGTCCTTCC ...
alignment bwa blat written 10 weeks ago by Maximilian Haeussler1.3k
Comment: C: UCSC MySQL query to find gene symbols for all RefSeq IDs?
... If you have RefSeq IDs to map to something else, I would use the NCBI efetch tools, as Pierre Lindenbaum suggests above. I would never use a third party webservice for a pipeline you want to run again. ...
written 5 months ago by Maximilian Haeussler1.3k
Comment: C: Running Bowtie As Service Or Daemon?
... On our server, Centos 6.8, the -shmem option hangs. I got around that by putting the index into /dev/shm and using --mm, which should be the same thing. ...
written 9 months ago by Maximilian Haeussler1.3k
Comment: C: Running Bowtie As Service Or Daemon?
... In a more current bowtie2 version, this exists now. ...
written 9 months ago by Maximilian Haeussler1.3k
Answer: A: BWA shm index preloading: only for BWA MEM?
... I read over the BWA source code and figured that yes, only "bwa mem" can use the mmaped index, "bwa aln" cannot. bowtie1 and bowtie2 both can use the mmap'ed index. Note that there is a github issue in the bwa repo on github where users report a 25% performance drop when using this option, so YMMY. ...
written 9 months ago by Maximilian Haeussler1.3k
Comment: C: Is there an open version of f1000
... Argh!! I was confused, sorry. Yes, I meant F1000prime. I wonder if many of their customers understand the difference between their products... ...
written 9 months ago by Maximilian Haeussler1.3k

Latest awards to Maximilian Haeussler

Centurion 10 weeks ago, created 100 posts.
Popular Question 4 months ago, created a question with more than 1,000 views. For BWA shm index preloading: only for BWA MEM?
Appreciated 9 months ago, created a post with more than 5 votes. For A: Drawing Chromosome Ideogams With Data
Supporter 10 months ago, voted at least 25 times.
Appreciated 2.1 years ago, created a post with more than 5 votes. For A: Drawing Chromosome Ideogams With Data
Teacher 2.2 years ago, created an answer with at least 3 up-votes. For A: Drawing Chromosome Ideogams With Data
Scholar 2.3 years ago, created an answer that has been accepted. For A: UCSC BedGraph Issue
Scholar 3.2 years ago, created an answer that has been accepted. For A: UCSC BedGraph Issue
Teacher 3.2 years ago, created an answer with at least 3 up-votes. For A: Drawing Chromosome Ideogams With Data
Scholar 3.5 years ago, created an answer that has been accepted. For A: UCSC BedGraph Issue
Popular Question 3.5 years ago, created a question with more than 1,000 views. For View Protein Domain Annotation On Multiple Alignment?
Guru 3.5 years ago, received more than 100 upvotes.
Scholar 3.6 years ago, created an answer that has been accepted. For A: UCSC BedGraph Issue
Appreciated 4.2 years ago, created a post with more than 5 votes. For A: Drawing Chromosome Ideogams With Data
Appreciated 4.3 years ago, created a post with more than 5 votes. For A: Drawing Chromosome Ideogams With Data
Good Answer 4.3 years ago, created an answer that was upvoted at least 5 times. For A: Getting Ucsc Data Via Mysql
Appreciated 4.8 years ago, created a post with more than 5 votes. For A: Drawing Chromosome Ideogams With Data
Appreciated 4.8 years ago, created a post with more than 5 votes. For A: Find All Genbank Submissions Associated With An Article Publication In 2005
Appreciated 4.8 years ago, created a post with more than 5 votes. For A: Is There Such A Thing As A Ucsc Api?
Appreciated 4.8 years ago, created a post with more than 5 votes. For A: Getting Ucsc Data Via Mysql
Appreciated 4.8 years ago, created a post with more than 5 votes. For A: Downloading Fasta Files
Appreciated 4.8 years ago, created a post with more than 5 votes. For A: Ngs Data Centers: Storage, Backup, Hardware Etc..
Good Answer 4.8 years ago, created an answer that was upvoted at least 5 times. For A: Is There Such A Thing As A Ucsc Api?
Good Answer 4.8 years ago, created an answer that was upvoted at least 5 times. For A: Getting Ucsc Data Via Mysql
Good Answer 4.8 years ago, created an answer that was upvoted at least 5 times. For A: Ngs Data Centers: Storage, Backup, Hardware Etc..


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1686 users visited in the last hour