User: Maximilian Haeussler

Reputation:
1,340
Status:
Trusted
Location:
UCSC
Website:
http://genome.ucsc.edu/
Last seen:
1 month, 1 week ago
Joined:
9 years, 3 months ago
Email:
m**********@gmail.com

Posts by Maximilian Haeussler

<prev • 108 results • page 1 of 11 • next >
0
votes
4
answers
11k
views
4
answers
Comment: C: Cell Type Marker Databases?
... As for examples of cases where this has worked, you can look at the licenses of OMIM, UCSC Genome Browser, Genomenom and HGMD, there may also be others, this list is not comprehensive. BIND used to be one, as was TRANSFAC, but I'm not sure about their status now. Usually there is either a fully publ ...
written 6 weeks ago by Maximilian Haeussler1.3k
0
votes
4
answers
11k
views
4
answers
Comment: C: Cell Type Marker Databases?
... I do not know an example of a successful biological database that is sold commercially for the reasons outlined above. I don't think there is a business model with biological databases. The only one I know who is making money is HGMD, but they provide a free academic version (always last year's and ...
written 6 weeks ago by Maximilian Haeussler1.3k
0
votes
4
answers
11k
views
4
answers
Comment: C: Cell Type Marker Databases?
... Wow, a commercial database for this. I have no idea how this would work for a research project. Say you use this database in a paper, no one else could reproduce the results? Also, this doesn't answer the question, like all of us, the question was about a public database, because we want to build al ...
written 3 months ago by Maximilian Haeussler1.3k
1
vote
0
answers
1.4k
views
0
answers
Comment: A: Sequence mapping with reciprocal-best but not liftover chains?
... For questions like this, please use the tag "UCSC" on your question and ideally also send a link to the question to the UCSC Genome Browser support group. Otherwise, they have no way of finding your question. ...
written 12 months ago by Maximilian Haeussler1.3k
0
votes
9
answers
5.0k
views
9
answers
Comment: C: Stranger Things: unexpected limitations of popular tools
... The UCSC bigBed format is something that comes very close: it has only very few defined minimal columns (chrom, start, end, score, strand) and you can add what you want. If the file has a certain structure, it's a PSL (called bigPsl) alignment. It can also be a gene model file when it has certain co ...
written 21 months ago by Maximilian Haeussler1.3k
1
vote
1
answer
618
views
1
answers
Answer: A: BWASW and _alt alleles
... So the answer seems to be (see comments above): bwa-sw does not support the XA tag. As such, you cannot get the alternative locations for multi-mapping sequences. This makes bwasw quite useless for most real-world applications that I can imagine, tasks that do not involve mapping reads to a genome. ...
written 22 months ago by Maximilian Haeussler1.3k
0
votes
1
answer
618
views
1
answers
Comment: C: BWASW and _alt alleles
... In this case, my input sequence can be <= 3000 bp.... but you're right, maybe I should use BWA-mem for this? I used bwasw because the input is pretty long, by BWAMEM standards. ...
written 22 months ago by Maximilian Haeussler1.3k
0
votes
1
answer
618
views
1
answers
Comment: C: BWASW and _alt alleles
... Oh wow, yes, it's indeed there, just not documented under bwasw but bwa backtrack: "Repetitive hits will be randomly chosen." manytThanks!! Well, yeah, I need to know the best match for the input sequence and the _alt match is definitely not a very useful match. I thought that BWA knew better these ...
written 22 months ago by Maximilian Haeussler1.3k
1
vote
1
answer
618
views
1
answer
BWASW and _alt alleles
... BWA-SW does not find all matches for me, it seems to pick only one random best match. I have no idea how to modify the arguments to have BWA find the secondary matches. Example: temp.fa: >hg38-chr6-test AACACAGGCCGGACAGAAGCTTGGAAGGTCCTGTCTCCCCAGGGAGGAGGCCCCTGGGACAGTGTGGCTCGTGTCCTTCC ...
alignment bwa blat written 22 months ago by Maximilian Haeussler1.3k
0
votes
1
answer
1.5k
views
1
answers
Comment: C: UCSC MySQL query to find gene symbols for all RefSeq IDs?
... If you have RefSeq IDs to map to something else, I would use the NCBI efetch tools, as Pierre Lindenbaum suggests above. I would never use a third party webservice for a pipeline you want to run again. ...
written 2.2 years ago by Maximilian Haeussler1.3k

Latest awards to Maximilian Haeussler

Good Answer 12 months ago, created an answer that was upvoted at least 5 times. For A: Getting Ucsc Data Via Mysql
Teacher 12 months ago, created an answer with at least 3 up-votes. For A: What Improvements Would You Recommend For This Genome Scaffolding Software?
Commentator 21 months ago, created a comment with at least 3 up-votes. For C: Where to get list of all Illumina adapters
Centurion 22 months ago, created 100 posts.
Popular Question 2.1 years ago, created a question with more than 1,000 views. For BWA shm index preloading: only for BWA MEM?
Appreciated 2.4 years ago, created a post with more than 5 votes. For A: Drawing Chromosome Ideogams With Data
Supporter 2.6 years ago, voted at least 25 times.
Appreciated 3.8 years ago, created a post with more than 5 votes. For A: Drawing Chromosome Ideogams With Data
Teacher 3.9 years ago, created an answer with at least 3 up-votes. For A: Drawing Chromosome Ideogams With Data
Scholar 4.0 years ago, created an answer that has been accepted. For A: UCSC BedGraph Issue
Scholar 4.9 years ago, created an answer that has been accepted. For A: UCSC BedGraph Issue
Teacher 4.9 years ago, created an answer with at least 3 up-votes. For A: Drawing Chromosome Ideogams With Data
Scholar 5.2 years ago, created an answer that has been accepted. For A: UCSC BedGraph Issue
Popular Question 5.2 years ago, created a question with more than 1,000 views. For View Protein Domain Annotation On Multiple Alignment?
Guru 5.2 years ago, received more than 100 upvotes.
Scholar 5.2 years ago, created an answer that has been accepted. For A: UCSC BedGraph Issue
Appreciated 5.8 years ago, created a post with more than 5 votes. For A: Drawing Chromosome Ideogams With Data
Appreciated 6.0 years ago, created a post with more than 5 votes. For A: Drawing Chromosome Ideogams With Data
Good Answer 6.0 years ago, created an answer that was upvoted at least 5 times. For A: Getting Ucsc Data Via Mysql
Appreciated 6.5 years ago, created a post with more than 5 votes. For A: Drawing Chromosome Ideogams With Data
Appreciated 6.5 years ago, created a post with more than 5 votes. For A: Find All Genbank Submissions Associated With An Article Publication In 2005
Appreciated 6.5 years ago, created a post with more than 5 votes. For A: Is There Such A Thing As A Ucsc Api?
Appreciated 6.5 years ago, created a post with more than 5 votes. For A: Getting Ucsc Data Via Mysql
Appreciated 6.5 years ago, created a post with more than 5 votes. For A: Downloading Fasta Files
Appreciated 6.5 years ago, created a post with more than 5 votes. For A: Ngs Data Centers: Storage, Backup, Hardware Etc..

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1578 users visited in the last hour