User: Maximilian Haeussler

Reputation:
1,330
Status:
Trusted
Location:
UCSC
Website:
http://genome.ucsc.edu/
Last seen:
2 weeks, 2 days ago
Joined:
8 years, 5 months ago
Email:
m**********@gmail.com

Posts by Maximilian Haeussler

<prev • 105 results • page 1 of 11 • next >
1
vote
0
answers
1.2k
views
0
answers
Comment: A: Sequence mapping with reciprocal-best but not liftover chains?
... For questions like this, please use the tag "UCSC" on your question and ideally also send a link to the question to the UCSC Genome Browser support group. Otherwise, they have no way of finding your question. ...
written 8 weeks ago by Maximilian Haeussler1.3k
0
votes
9
answers
4.6k
views
9
answers
Comment: C: Stranger Things: unexpected limitations of popular tools
... The UCSC bigBed format is something that comes very close: it has only very few defined minimal columns (chrom, start, end, score, strand) and you can add what you want. If the file has a certain structure, it's a PSL (called bigPsl) alignment. It can also be a gene model file when it has certain co ...
written 11 months ago by Maximilian Haeussler1.3k
1
vote
1
answer
395
views
1
answers
Answer: A: BWASW and _alt alleles
... So the answer seems to be (see comments above): bwa-sw does not support the XA tag. As such, you cannot get the alternative locations for multi-mapping sequences. This makes bwasw quite useless for most real-world applications that I can imagine, tasks that do not involve mapping reads to a genome. ...
written 12 months ago by Maximilian Haeussler1.3k
0
votes
1
answer
395
views
1
answers
Comment: C: BWASW and _alt alleles
... In this case, my input sequence can be <= 3000 bp.... but you're right, maybe I should use BWA-mem for this? I used bwasw because the input is pretty long, by BWAMEM standards. ...
written 12 months ago by Maximilian Haeussler1.3k
0
votes
1
answer
395
views
1
answers
Comment: C: BWASW and _alt alleles
... Oh wow, yes, it's indeed there, just not documented under bwasw but bwa backtrack: "Repetitive hits will be randomly chosen." manytThanks!! Well, yeah, I need to know the best match for the input sequence and the _alt match is definitely not a very useful match. I thought that BWA knew better these ...
written 12 months ago by Maximilian Haeussler1.3k
1
vote
1
answer
395
views
1
answer
BWASW and _alt alleles
... BWA-SW does not find all matches for me, it seems to pick only one random best match. I have no idea how to modify the arguments to have BWA find the secondary matches. Example: temp.fa: >hg38-chr6-test AACACAGGCCGGACAGAAGCTTGGAAGGTCCTGTCTCCCCAGGGAGGAGGCCCCTGGGACAGTGTGGCTCGTGTCCTTCC ...
alignment bwa blat written 12 months ago by Maximilian Haeussler1.3k
0
votes
1
answer
1.1k
views
1
answers
Comment: C: UCSC MySQL query to find gene symbols for all RefSeq IDs?
... If you have RefSeq IDs to map to something else, I would use the NCBI efetch tools, as Pierre Lindenbaum suggests above. I would never use a third party webservice for a pipeline you want to run again. ...
written 15 months ago by Maximilian Haeussler1.3k
0
votes
2
answers
1.7k
views
2
answers
Comment: C: Running Bowtie As Service Or Daemon?
... On our server, Centos 6.8, the -shmem option hangs. I got around that by putting the index into /dev/shm and using --mm, which should be the same thing. ...
written 19 months ago by Maximilian Haeussler1.3k
0
votes
2
answers
1.7k
views
2
answers
Comment: C: Running Bowtie As Service Or Daemon?
... In a more current bowtie2 version, this exists now. ...
written 19 months ago by Maximilian Haeussler1.3k
0
votes
1
answer
1.6k
views
1
answers
Answer: A: BWA shm index preloading: only for BWA MEM?
... I read over the BWA source code and figured that yes, only "bwa mem" can use the mmaped index, "bwa aln" cannot. bowtie1 and bowtie2 both can use the mmap'ed index. Note that there is a github issue in the bwa repo on github where users report a 25% performance drop when using this option, so YMMY. ...
written 19 months ago by Maximilian Haeussler1.3k

Latest awards to Maximilian Haeussler

Good Answer 8 weeks ago, created an answer that was upvoted at least 5 times. For A: Getting Ucsc Data Via Mysql
Teacher 8 weeks ago, created an answer with at least 3 up-votes. For A: What Improvements Would You Recommend For This Genome Scaffolding Software?
Commentator 11 months ago, created a comment with at least 3 up-votes. For C: Where to get list of all Illumina adapters
Centurion 12 months ago, created 100 posts.
Popular Question 15 months ago, created a question with more than 1,000 views. For BWA shm index preloading: only for BWA MEM?
Appreciated 19 months ago, created a post with more than 5 votes. For A: Drawing Chromosome Ideogams With Data
Supporter 20 months ago, voted at least 25 times.
Appreciated 3.0 years ago, created a post with more than 5 votes. For A: Drawing Chromosome Ideogams With Data
Teacher 3.1 years ago, created an answer with at least 3 up-votes. For A: Drawing Chromosome Ideogams With Data
Scholar 3.1 years ago, created an answer that has been accepted. For A: UCSC BedGraph Issue
Scholar 4.1 years ago, created an answer that has been accepted. For A: UCSC BedGraph Issue
Teacher 4.1 years ago, created an answer with at least 3 up-votes. For A: Drawing Chromosome Ideogams With Data
Scholar 4.3 years ago, created an answer that has been accepted. For A: UCSC BedGraph Issue
Popular Question 4.4 years ago, created a question with more than 1,000 views. For View Protein Domain Annotation On Multiple Alignment?
Guru 4.4 years ago, received more than 100 upvotes.
Scholar 4.4 years ago, created an answer that has been accepted. For A: UCSC BedGraph Issue
Appreciated 5.0 years ago, created a post with more than 5 votes. For A: Drawing Chromosome Ideogams With Data
Appreciated 5.1 years ago, created a post with more than 5 votes. For A: Drawing Chromosome Ideogams With Data
Good Answer 5.1 years ago, created an answer that was upvoted at least 5 times. For A: Getting Ucsc Data Via Mysql
Appreciated 5.7 years ago, created a post with more than 5 votes. For A: Drawing Chromosome Ideogams With Data
Appreciated 5.7 years ago, created a post with more than 5 votes. For A: Find All Genbank Submissions Associated With An Article Publication In 2005
Appreciated 5.7 years ago, created a post with more than 5 votes. For A: Is There Such A Thing As A Ucsc Api?
Appreciated 5.7 years ago, created a post with more than 5 votes. For A: Getting Ucsc Data Via Mysql
Appreciated 5.7 years ago, created a post with more than 5 votes. For A: Downloading Fasta Files
Appreciated 5.7 years ago, created a post with more than 5 votes. For A: Ngs Data Centers: Storage, Backup, Hardware Etc..

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2305 users visited in the last hour