User: Juan Manuel Berros

Reputation:
90
Status:
Trusted
Location:
Buenos Aires, Argentina
Website:
https://github.com/jmb...
Twitter:
@jmberros
Last seen:
1 week, 5 days ago
Joined:
5 years, 5 months ago
Email:
j***********@gmail.com

Python programmer with some Rails web dev background. Nowadays, I mostly use: pandas, matplotlib, seaborn, Jupyter, MySQL, Redis, GATK suite, plink, bwa, bcftools, samtools, bedtools.

Posts by Juan Manuel Berros

<prev • 14 results • page 1 of 2 • next >
0
votes
2
answers
3.0k
views
2
answers
Comment: C: Extracting the Country from a >200 sequences Genbank file
... It seems the key for the date is `collection_date`, not `collection`. Try changing that. ...
written 5 months ago by Juan Manuel Berros90
1
vote
1
answer
199
views
1
answer
Why does GWAS Catalog mix OR and beta in the same column?
... All associations in GWAS Catalog can be downloaded here: https://www.ebi.ac.uk/gwas/docs/file-downloads However, the Odds Ratios (ORs) from cases/controls studies and the betas from continuous phenotypes are mixed in a single column called "OR_or_beta". Why would they do that? ORs and betas are nat ...
gwas_catalog gwas or written 7 months ago by Juan Manuel Berros90 • updated 12 days ago by zhoufeng2ye0
0
votes
0
answers
1.3k
views
0
answers
Comment: C: Plink 1.9 "File read failure" error when merging with --bmerge
... Any news on this, @svendula? I'm facing the same issue. ...
written 18 months ago by Juan Manuel Berros90
0
votes
1
answer
1.1k
views
1
answers
Comment: C: Concat VCFs with some shared samples
... Yep, I wanted a "block of code", but ```...``` did not preserve newlines. I just tried the [101|010] edit button but the result seems to be the same right? What's the usual way to insert a code block here? ...
written 2.1 years ago by Juan Manuel Berros90 • updated 2.1 years ago by _r_am32k
1
vote
1
answer
1.1k
views
1
answers
Answer: A: Concat VCFs with some shared samples
... I was struggling with a similar issue and [CombineVariants][1] was the answer, as @RamRS suggested. (Thanks!) I had `chr8.vcf.gz` and `chrY.vcf.gz` files with some shared samples. More specifically, male samples were shared by both files, but female samples were absent from `chrY.vcf.gz`. After ind ...
written 2.1 years ago by Juan Manuel Berros90
1
vote
5
answers
4.6k
views
5
answers
Answer: A: Programatically retrieving CLINVAR records, with the same detail level as it is
... I'm replying 2 years after this has been posted, but it might prove helpful to other ppl with the same issue. I found this after playing around for a while with NCBI's API, which can be not-as-helpful as one might expect. The quick answer is that you need to change the `retmode=json` to `retmode=va ...
written 3.3 years ago by Juan Manuel Berros90
0
votes
5
answers
4.6k
views
5
answers
Comment: C: Programatically retrieving CLINVAR records, with the same detail level as it is
... EDIT: I added my reply at the bottom, where it belongs, not as a side comment. ...
written 3.3 years ago by Juan Manuel Berros90
0
votes
2
answers
3.5k
views
2
answers
Comment: C: Searching for ClinVar entries based on SNP annotation
... I second this, MyVariant.info is a great tool. Once you got the variation IDs from MyVariant, you can further use them to fetch more data from Entrez itself. While on Python, if you have `biopython` installed, you can do: ```python from Bio import Entrez Entrez.email = 'foo@bar.com' # your email h ...
written 3.3 years ago by Juan Manuel Berros90
1
vote
0
answers
1.7k
views
0
answers
Tool: bed_to_tabix: Download the variants from 1,000 Genomes in the regions defined in one or more BED files.
... I wrote this tool to easily get variant genotypes from different populations, using the data from The 1,000 Genomes Project. You just provide one or more BED files and you get a VCF. I hope it's useful! -- **bed_to_tabix** `bed_to_tabix` will download a gzipped VCF file with the 2,504 genotypes ...
cli python 1000genomes tool linux written 4.2 years ago by Juan Manuel Berros90
0
votes
1
answer
1.2k
views
1
answers
Answer: A: Extract aligned parts of sequence to reference to new file
... Hey. I'm not sure I understand what kind of output you need. Using the text you provided, a simple grep command can keep the nucleotides and remove the gaps ("-") --though I'm not sure this is what you need: $ cat /tmp/test AT01G1234567 ATCGATCGATGCGCGCTAGCTGAATCGATCGGATCGCGGTAGCTGGAG ...
written 4.2 years ago by Juan Manuel Berros90

Latest awards to Juan Manuel Berros

Popular Question 2.0 years ago, created a question with more than 1,000 views. For Can PLINK handle gzipped ped / map files?
Popular Question 3.1 years ago, created a question with more than 1,000 views. For Can PLINK handle gzipped ped / map files?
Teacher 3.7 years ago, created an answer with at least 3 up-votes. For A: Extracting the Country from a >200 sequences Genbank file
Autobiographer 4.2 years ago, has more than 80 characters in the information field of the user's profile.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1702 users visited in the last hour
_