User: majeedaasim

gravatar for majeedaasim
New User
United States
Last seen:
4 months, 1 week ago
2 years, 10 months ago

Posts by majeedaasim

<prev • 68 results • page 1 of 7 • next >
model selection for MrBayes.
... I am using nucleotide sequences for baseyan phylogenetic analysis. The program MrBayes involves the parameter of specifying the model. Does this tool have any option of automatic selection of best fit model as in other ML programs? If no, how to determine which model to use? Thanks ...
baseyan tree model selection written 4 months ago by majeedaasim20 • updated 4 months ago by abhishek.abhishekkumar20
Comment: C: how to subset sequences based on IDs, but order shall remain preserved?
... My ID file entries are like Tw_Wn_DN127031_c0_g1_i5 Tw_Wn_DN118882_c0_g1_i2 Tw_Wn_DN121684_c0_g1_i2 Tw_Wn_DN127037_c0_g1_i1 Tw_Wn_DN134530_c2_g4_i7 Tw_Wn_DN117797_c0_g1_i1 the script says Died at line 14. ...
written 5 months ago by majeedaasim20
Comment: C: extract sequences based on ids file
... I just typed in terminal but I am getting nothing, where is the result file produced. while read -r line; do awk -v pattern=$line -v RS=">" '$0 ~ pattern { printf(">%s", $0); }' my_final_seq.fa; done < my_final_Ids.txt ...
written 5 months ago by majeedaasim20
Comment: C: extract sequences based on ids file
... Do I need to cat file even if I have all the sequences and IDs list in their corresponding files ...
written 5 months ago by majeedaasim20
Comment: C: extract sequences based on ids file
... Alex, I have a fasta file containing many sequences like >Seq1 atgccaaagtagatacagatagac >seq2 atattagacagatacaatagacag >seq3 aggagatacagatacagatac >seq4 atgacagatacagatacagatacagat >seq5 agtagataacacagatagacagat >seq6 agtaacagtacagat ...
written 5 months ago by majeedaasim20
Comment: C: extract sequences based on ids file
... I Tried it by typing the same in the terminal but the result file is empty. ...
written 5 months ago by majeedaasim20
Comment: C: how to subset sequences based on IDs, but order shall remain preserved?
... I tried it but it produces the same contents as ID file. NO sequences are extracted. ...
written 5 months ago by majeedaasim20
Comment: C: how to subset sequences based on IDs, but order shall remain preserved?
... sequence file >abc atgcggatacagataca >def atgcggccaaaatt >ghi atggggaattcacaac >jkl aggatattatatccg Now filter according to Ids list like abc jkl ...
written 5 months ago by majeedaasim20
Comment: C: how to subset sequences based on IDs, but order shall remain preserved?
... yes I have fasta sequence file and an ID file. THe sequences need to be extracted from the sequence file according to the entries in the ID file but the order of sequences in the outfile shall be same as ID file entries. ...
written 5 months ago by majeedaasim20
Comment: C: how to subset sequences based on IDs, but order shall remain preserved?
... Thanks, but link is not working ...
written 5 months ago by majeedaasim20

Latest awards to majeedaasim

No awards yet. Soon to come :-)


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1603 users visited in the last hour