User: majeedaasim

gravatar for majeedaasim
majeedaasim20
Reputation:
20
Status:
New User
Location:
United States
Last seen:
11 hours ago
Joined:
2 years, 4 months ago
Email:
m**********@gmail.com

Posts by majeedaasim

<prev • 45 results • page 1 of 5 • next >
0
votes
1
answer
49
views
1
answer
HOw to delete a specific text from description line 1 of a fastaq file ?
... I have a fastq file to run TRinity on it. BUt I am getting an error which arises due to the following problem HWI-ST499:111:D0G94ACXX:6:2203:18045:47806_forward/1 CACCCATCTGAGCTAATGTGCCCCATTTATTCTCACGTTATCAAACCTACAAAGGCCACTTCTCTCCAACTCCTCACTTCACCTTAGTGCAATCGGTAGAC + CCCFFFFFHHHHHJJJ ...
fastq modification in description written 12 hours ago by majeedaasim20 • updated 12 hours ago by Pierre Lindenbaum103k
0
votes
1
answer
59
views
1
answer
Problem in installing rMATS through conda?
... I tried to install rMATS through conda using the command: conda install -c bioconda rmats Following error appears: UnsatisfiableError: The following specifications were found to be in conflict: - pexpect - rmats Use "conda info " to see the dependencies for ...
rmats conda written 13 hours ago by majeedaasim20 • updated 10 hours ago by Vimalkumar Velayudhan60
0
votes
1
answer
107
views
1
answers
Comment: C: Processing of sequences for CodonW use
... Thanks a lot for help ...
written 4 days ago by majeedaasim20
0
votes
1
answer
107
views
1
answers
Comment: C: Processing of sequences for CodonW use
... I have a denovo assembled transcriptome ...
written 4 days ago by majeedaasim20
0
votes
1
answer
107
views
1
answer
Processing of sequences for CodonW use
... I need to perform codon usage analysis. I read about CodonW and CodonO. From the literature, input sequence needs to be first checked for accuracy. The input sequence shall have 1. Shall be full length 2.No codons of transposons 3. No internal stop codons. I require help in the sense of processing ...
codin usage bias codonw written 5 days ago by majeedaasim20 • updated 4 days ago by h.mon10k
1
vote
1
answer
97
views
1
answer
(Closed) Problem in using trinity at https://galaxy.ncgas-trinity.indiana.edu/
... I am using trinity at https://galaxy.ncgas-trinity.indiana.edu/ After uploading the fastq files I just ran trinity but it doesnt work it ends in fatal error. In usegalaxy.org, I first modify the fastq files through Fastq Groomer before operating trinity which works well. But in https://galaxy.ncgas ...
trinity written 11 days ago by majeedaasim20 • updated 11 days ago by Michael Dondrup43k
0
votes
4
answers
211
views
4
answers
Comment: C: HOw to modify the description line 1 of a fastaq file to match with third line?
... It tried it, but the description was same and there was no impact. Also one point I shall mention is that the change shall take place in all reads and not in a single read as the code you mentioned reflects. Thanks ...
written 14 days ago by majeedaasim20
0
votes
4
answers
211
views
4
answers
Comment: C: HOw to modify the description line 1 of a fastaq file to match with third line?
... I agree and indeed the "length=100" causes the problem so doesn't match. ...
written 15 days ago by majeedaasim20
0
votes
4
answers
211
views
4
answers
Comment: C: HOw to modify the description line 1 of a fastaq file to match with third line?
... thanks toralmanvar it works But what if the SRR... is present in the the beginning of the first line as SRR1188607.1@HWI-ST915_0064:2:1101:1498:2108/1 And I want to get rid of these SRR IDs to begin the description line with @HWI- onwards ...
written 15 days ago by majeedaasim20
4
votes
4
answers
211
views
5 follow
4
answers
HOw to modify the description line 1 of a fastaq file to match with third line?
... I am using paired end SRA data, it looks like this @HWI-ST915_0064:2:1101:1420:2104/1 GTCTCTTCGCACGCTTTCACTGTGAACGGTTCGGCATCGAGAAGGACGCAGTTCCTCTCCGGCTTGGACCAGTTTCTGGTGGCCACGGCTGCCCCCATCC +SRR1188607.1 HWI-ST915_0064:2:1101:1420:2104 length=100 HDHHHHHHHHHHHHHHHHHHHHHHGHHHHHHHHHHHHH ...
fastq header modification written 15 days ago by majeedaasim20 • updated 15 days ago by cpad01124.1k

Latest awards to majeedaasim

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1174 users visited in the last hour