Moderator: cpad0112

gravatar for cpad0112
cpad011214k
Reputation:
14,310
Status:
Trusted
Location:
Hyderabad India
Last seen:
12 hours ago
Joined:
5 years, 4 months ago
Email:
c*******@gmail.com

Posts by cpad0112

<prev • 2,372 results • page 1 of 238 • next >
0
votes
1
answer
110
views
1
answers
Comment: C: Script for making exon file
... with [seqkit][1] and awk (seqkit linearizes fasta): seqkit seq -w 0 file.fa | awk -v OFS="\n" '/^>/ {getline seq}{L=length(seq); L2=int(L/2); print $0, substr(seq,L2+1) substr(seq,1,L2) }' output: >ENSE00002234944 CAAGCTGAGCACTGGAGTGGAGTTTTCCTGTGGAGAGGAGCCATGCCTAGAGTGGGAT ...
written 3 days ago by cpad011214k
0
votes
1
answer
86
views
1
answers
Answer: C: trimming of fasta file
... $ awk -v OFS="\n" '/^>/ {getline seq}{print $0,substr(seq,length(seq)/2-75,150)}' test.fa >read1 CAGGTCTGGCTGGATGAAGGGCACGGCATAGGTCTGACCTGCCAGGGAGTGCTGCATCCTCACAGGAGTCATGGTGCTGCTGAAGATGTCTCCAGAGACCTTCTGCAGGTACTGCAGGGCATCCGCCATCTGCTGGACGGCCTCCTCTCG >read2 TTGTGAGTCA ...
written 3 days ago by cpad011214k
0
votes
3
answers
60
views
3
answers
Answer: C: Read detection with pattern in paired end FASTQ file
... With [seqkit][1]: $ seqkit grep -srip "TGTATGTAAACTTCCGACTTCAACTGTA" input.fq(.gz) [1]: https://github.com/shenwei356/seqkit ...
written 5 days ago by cpad011214k
0
votes
2
answers
104
views
2
answers
Answer: A: data prerprocessing coding
... library(sqldf) input: > data_1 id s1 s2 s3 s4 1 a 1 0 2 1 2 b 2 0 1 2 3 b 0 0 1 1 4 c 0 1 2 2 > data_2 id here 1 a a1 2 b a2 3 c a3 output: > sqldf('select d1.*, d2."here" from data_1 as d1 join data ...
written 7 days ago by cpad011214k
0
votes
2
answers
104
views
2
answers
Comment: C: data prerprocessing coding
... with join function: $ join -1 1 -2 1 data1.txt data2.txt -t $'\t' id s1 s2 s3 s4 here a 1 0 2 1 a1 b 2 0 1 2 a2 b 0 0 1 1 a2 c 0 1 2 2 a3 with [tsv-utils][1] join function: input: $ cat data1.txt id s1 s2 s3 s4 a 1 0 2 1 b 2 0 1 2 b 0 0 1 1 ...
written 7 days ago by cpad011214k
0
votes
2
answers
191
views
2
answers
Answer: C: data prerprocessing coding
... with datamash: input: $ cat file.txt rowid s1 s2 s3 s4 s5 r1 0 16 15 14 4 r1 3 13 7 10 9 r1 5 11 16 5 5 r1 20 1 20 7 9 r1 15 18 1 18 7 r2 12 20 7 14 9 r2 18 0 14 20 2 r2 15 3 6 1 5 r2 20 7 5 10 0 r2 17 4 10 12 19 output: $ datamash -sH -g ...
written 8 days ago by cpad011214k
0
votes
4
answers
202
views
4
answers
Comment: C: How to extract a sequence below a fasta header (">") from a fasta file ?
... another awk solution for flattend fasta file: $ awk -v OFS="\n" '/^>/ {getline seq} {if ($0==">NODE_19_length_5758_cluster_19_candidate_1") print $0,seq}' test.fa for printing sequence only: $ awk -v OFS="\n" '/^>/ {getline seq} {if ($0==">NODE_19_length_5758_cluster_19_candid ...
written 8 days ago by cpad011214k
0
votes
4
answers
202
views
4
answers
Comment: C: How to extract a sequence below a fasta header (">") from a fasta file ?
... $ seqkit grep -w 0 -ip NODE_19_length_5758_cluster_19_candidate_1 input.fa for printing sequence only: $ seqkit grep -ip NODE_19_length_5758_cluster_19_candidate_1 test.fa | seqkit seq -s -w 0 ...
written 8 days ago by cpad011214k
1
vote
1
answer
152
views
1
answers
Answer: C: How to check if a Fastq file is contaminated with other strains?
... Use fastqscreen. 1. Download the genomes of suspect organisms. 2. Index them 3. Use fastqscreen to check the contamination. By default, fastqscreen, checks for few model genomes and contaminating vector sequences. One can supply genomes and sequences externally and check for contamination. In ...
written 15 days ago by cpad011214k
0
votes
2
answers
130
views
2
answers
Comment: C: remove empty reads from fastq files
... try `cutadapt` minimum length option or `seqkit seq --min-len` option ...
written 17 days ago by cpad011214k

Latest awards to cpad0112

Appreciated 6 days ago, created a post with more than 5 votes. For C: geom_bar plot with several variables
Appreciated 28 days ago, created a post with more than 5 votes. For C: geom_bar plot with several variables
Appreciated 28 days ago, created a post with more than 5 votes. For A: Visualize nucleotides for every position in R
Scholar 7 weeks ago, created an answer that has been accepted. For A: .fai file generation for a vcf file containing snps
Teacher 7 weeks ago, created an answer with at least 3 up-votes. For A: Finding the iIllumina index read from raw fastq file
Teacher 9 weeks ago, created an answer with at least 3 up-votes. For A: Finding the iIllumina index read from raw fastq file
Good Answer 11 weeks ago, created an answer that was upvoted at least 5 times. For C: geom_bar plot with several variables
Teacher 3 months ago, created an answer with at least 3 up-votes. For A: Finding the iIllumina index read from raw fastq file
Teacher 3 months ago, created an answer with at least 3 up-votes. For A: Finding the iIllumina index read from raw fastq file
Scholar 3 months ago, created an answer that has been accepted. For A: .fai file generation for a vcf file containing snps
Good Answer 4 months ago, created an answer that was upvoted at least 5 times. For C: Metagenomic Data management
Teacher 4 months ago, created an answer with at least 3 up-votes. For A: Finding the iIllumina index read from raw fastq file
Good Answer 4 months ago, created an answer that was upvoted at least 5 times. For C: Metagenomic Data management
Scholar 4 months ago, created an answer that has been accepted. For A: .fai file generation for a vcf file containing snps
Appreciated 4 months ago, created a post with more than 5 votes. For C: can someone read this result to me
Teacher 4 months ago, created an answer with at least 3 up-votes. For A: Finding the iIllumina index read from raw fastq file
Commentator 4 months ago, created a comment with at least 3 up-votes. For C: Problem installing Rgraphviz in R
Scholar 5 months ago, created an answer that has been accepted. For A: .fai file generation for a vcf file containing snps
Appreciated 5 months ago, created a post with more than 5 votes. For C: can someone read this result to me
Appreciated 5 months ago, created a post with more than 5 votes. For C: can someone read this result to me
Scholar 5 months ago, created an answer that has been accepted. For A: .fai file generation for a vcf file containing snps
Appreciated 6 months ago, created a post with more than 5 votes. For A: Analysis past the differentially expressed genes: RNAseq
Scholar 6 months ago, created an answer that has been accepted. For A: .fai file generation for a vcf file containing snps
Appreciated 6 months ago, created a post with more than 5 votes. For A: Analysis past the differentially expressed genes: RNAseq
Appreciated 7 months ago, created a post with more than 5 votes. For A: Analysis past the differentially expressed genes: RNAseq

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1927 users visited in the last hour
_