User: bioinforesearchquestions

Reputation:
50
Status:
Trusted
Location:
United States
Last seen:
2 days, 1 hour ago
Joined:
1 year, 5 months ago
Email:
b***********************@gmail.com

Posts by bioinforesearchquestions

<prev • 126 results • page 1 of 13 • next >
0
votes
2
answers
100
views
2
answers
Comment: C: How to cluster reads within the fastq file? Is their any tool?
... Oh, I used Bowtie2. I will try with Bowtie1 now. I will also search for Brian Bushnell post on miRNA data. ...
written 4 days ago by bioinforesearchquestions50
0
votes
2
answers
100
views
2
answers
Comment: C: How to cluster reads within the fastq file? Is their any tool?
... Thanks, Alex for your links and suggestions. I will try both of them. ...
written 4 days ago by bioinforesearchquestions50
0
votes
2
answers
100
views
2
answers
Comment: C: How to cluster reads within the fastq file? Is their any tool?
... Thanks, Genomax2. I will write a perl script to calculate the frequency. Firstly, I trimmed off the 3'adapter from our reads using Trimmomatic tool. Then aligned my trimmed reads against the all_mature_miRNA_sequence.fa from miRBase database using the Bowtie2 alignment tool. I have 2,148,364 reads ...
written 4 days ago by bioinforesearchquestions50
0
votes
2
answers
100
views
2
answers
Comment: C: How to cluster reads within the fastq file? Is their any tool?
... Thanks a lot, Genomax2. I will read the post and play around with the tool. The reason why I would like to cluster the reads is, I am working on miRNAs which have conserved regions in them. ...
written 4 days ago by bioinforesearchquestions50
2
votes
2
answers
100
views
2
answers
How to cluster reads within the fastq file? Is their any tool?
... Hi folks, I am planning to cluster similar reads from a fastq file. For example: read1 (length-30): AGTCGATCGATCGAGTCTGCGTCGATCGGG(30 bases) read2 (length-28): AGTCGATCGATCGAGTCTGCGTCGATCG (28 bases are matching) read3 (length-25): - - - CGATCGATCGAGTCTGCGTCGAT - - (25 bases are ma ...
reads assembly fastq alignment clustering written 4 days ago by bioinforesearchquestions50 • updated 4 days ago by Alex Reynolds17k
0
votes
0
answers
229
views
0
answers
Comment: C: cluster and determine frequency of reads in fastq file
... Hi Mccormack, I am also interested doing the same. I am working on the miRNA. They have well conserved regions in them. So I would like to determine the frequency of each reads and want them to cluster it using fastq file. Can you please share your inputs? ...
written 5 days ago by bioinforesearchquestions50
0
votes
0
answers
59
views
0
answers
Comment: C: miR KEGG enrichment in Arabidopsis
... Thanks, JNF. Currently, I am looking at the preprocessing step. Would you be able to check with that researcher about the above queries? ...
written 5 days ago by bioinforesearchquestions50
0
votes
0
answers
59
views
0
answers
Comment: C: miR KEGG enrichment in Arabidopsis
... Hi JNF3769, I am also working on miRNA's. I have single end fastq files from sequencing centre. I trimmed my fastq files only at the 3'end. The reason for trimming is, generally miRNAs are smaller, so the sequencing machine will sequence the adapter region. Illumina-SmallRNAAdapter.fa >RNA 3 Ad ...
written 5 days ago by bioinforesearchquestions50
0
votes
0
answers
51
views
0
answers
mirBase mature microRNA sequences have base U instead of base T. Should I change or not?
... Hi Friends, Recently we sequenced small RNA sequencing using Rapid Run platform. As the size of the small RNA ranges between 18 to 35bases. The reads from this run would have bases sequenced from the adapters and primers. I am planning to trim off the adapters and primers. Step1: Trimming the adap ...
0
votes
0
answers
54
views
0
answers
Do I need to download any specific adapters for Illumina small RNA sequencing kit?
... Hi Friends, Recently we sequenced small RNA sequencing using Rapid Run platform. As the size of the small RNA ranges between 18 to 35bases. The reads from this run would have bases sequenced from the adapters and primers. I am planning to trim off the adapters and primers. I am currently using Tri ...

Latest awards to bioinforesearchquestions

Popular Question 4 months ago, created a question with more than 1,000 views. For Applying hard filters for variants
Supporter 4 months ago, voted at least 25 times.
Centurion 4 months ago, created 100 posts.
Popular Question 5 months ago, created a question with more than 1,000 views. For Applying hard filters for variants

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 516 users visited in the last hour