User: bioinforesearchquestions

Reputation:
90
Status:
Trusted
Location:
United States
Last seen:
6 hours ago
Joined:
1 year, 11 months ago
Email:
b***********************@gmail.com

Posts by bioinforesearchquestions

<prev • 158 results • page 1 of 16 • next >
0
votes
0
answers
100
views
0
answers
Comment: C: At which position, should I expect a peak for miRNA sequenced FASTQ reads?
... Thanks, genomax. I will read the reference you provided. I am curious, 1) why am I getting way bigger peak at 25th position compared to 22th position for the first case? similarly, way bigger peak at 35th position compared to 22th position for the second case? I assumed that the trimming of adapt ...
written 6 days ago by bioinforesearchquestions90
0
votes
0
answers
100
views
0
answers
At which position, should I expect a peak for miRNA sequenced FASTQ reads?
... Hi, I did two different trimming just to see the trend using trimmomatic tool. First case: trimmed this adapter "TGGAATTCTCGGGTGCCAAGG" and then retained the reads only between this range **18-25** (minimum read length is 18 bases and **CROP is 25**). Here, I could see two peaks one at 22 and ano ...
smallrna fastq rna-seq mirna written 6 days ago by bioinforesearchquestions90
0
votes
0
answers
159
views
0
answers
Comment: C: What is the acceptable percentage of reads with adapters sequenced in miRNA sequ
... Hi Genomax, I did two different trimming just to see the trend using trimmomatic tool. First case: trimmed this adapter "TGGAATTCTCGGGTGCCAAGG" and then retained the reads only between this range **18-25** (minimum read length is 18 bases and **CROP is 25**). Here, I could see two peaks one at 22 ...
written 6 days ago by bioinforesearchquestions90
0
votes
0
answers
159
views
0
answers
Comment: C: What is the acceptable percentage of reads with adapters sequenced in miRNA sequ
... Hi Asaf, yes I was expecting adapters to be part of my sequenced reads. But I want to know the percentage which I am getting is reasonable or low or high? For example, as per this mirdeep2 tutorial page (https://drmirdeep.github.io/mirdeep2_tutorial.html), I pasted the contents for your reference ...
written 7 days ago by bioinforesearchquestions90
0
votes
0
answers
159
views
0
answers
Comment: C: What is the acceptable percentage of reads with adapters sequenced in miRNA sequ
... I suspect they should be 20-25 bases long. ...
written 7 days ago by bioinforesearchquestions90
0
votes
0
answers
159
views
0
answers
Comment: C: What is the acceptable percentage of reads with adapters sequenced in miRNA sequ
... We sequenced 51 cycles. I checked for this adapter but only this sequence "**TGGAATTC**" in raw reads >RNA 3 Adapter **TGGAATTC**TCGGGTGCCAAGG ...
written 7 days ago by bioinforesearchquestions90
0
votes
0
answers
126
views
0
answers
Comment: C: Is there any recommended steps/pipeline for identifying differential miRNA expre
... Thanks for your response Biofalconch. I have referred this paper and tool for miRNA expression profiling. I used the mirna_soft tool (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4138881/). I am working on both bovine and pig. What do you think about this workflow, from miRBase I extracted bovin ...
written 7 days ago by bioinforesearchquestions90
2
votes
0
answers
159
views
0
answers
What is the acceptable percentage of reads with adapters sequenced in miRNA sequencing?
... Hi Folks, I am working on miRNA sequenced reads using Illumina (51bp, single-end reads). A - Sample B - Total reads C - Reads_with_adapter_sequences D - Per_of_reads_with_adapters > **A** ----------- **B** ------------- **C** ------------ **D** > > Sample1 - 6,272,535 - ...
0
votes
1
answer
245
views
1
answers
Comment: C: Difference between CPM and RPM for RNA-seq reada quantification
... Hi V82masae, I am working on both bovine and pig. What do you think about this workflow, from miRBase I extracted bovine and pig related miRNAs from mature.fa (miRBase) file. Using miRNA_soft tool as per the research article I provided in the previous comment, I counted the reads mapped to bovine ...
written 8 days ago by bioinforesearchquestions90
0
votes
0
answers
100
views
0
answers
Do I have to compared sequenced miRNA reads against bovine miRNA from miRBase mature.fa sequence or entire bovine genome?
... Hello friends, I have sequenced reads from bovine miRNA (single end, raw reads 51bp). I have two groups. Each group with 4 repeats. For example: - GroupA (GroupA_1, GroupA_2, GroupA_3, GroupA_4) - GroupB (GroupB_1, GroupB_2, GroupB_3, GroupB_4) After trimming, I retained the reads with length ...
small rna rna-seq mirna written 13 days ago by bioinforesearchquestions90

Latest awards to bioinforesearchquestions

Popular Question 3 months ago, created a question with more than 1,000 views. For Applying hard filters for variants
Popular Question 4 months ago, created a question with more than 1,000 views. For Applying hard filters for variants
Popular Question 5 months ago, created a question with more than 1,000 views. For Applying hard filters for variants
Popular Question 10 months ago, created a question with more than 1,000 views. For Applying hard filters for variants
Supporter 10 months ago, voted at least 25 times.
Centurion 10 months ago, created 100 posts.
Popular Question 11 months ago, created a question with more than 1,000 views. For Applying hard filters for variants

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 914 users visited in the last hour