User: saamar.rajput

gravatar for saamar.rajput
Reputation:
20
Status:
New User
Location:
Germany
Last seen:
1 month, 2 weeks ago
Joined:
3 years, 10 months ago
Email:
s************@gmail.com

Posts by saamar.rajput

<prev • 41 results • page 1 of 5 • next >
0
votes
1
answer
187
views
1
answers
Comment: C: Overlay two ggplots
... This brings both the plot in one picture, but I want the Go terms to appear once and upregulated bar plots at one side and downregulated bar plot on the other side. This means the GO terms would be once in the middle. ...
written 12 weeks ago by saamar.rajput20
0
votes
1
answer
187
views
5 follow
1
answer
Overlay two ggplots
... I am making bar plots using ggplot for the GO enrichment analysis I did. Now I have upregulated Go terms and downregulated GO terms. My data looks like this: head(Up) GO Percentage q.val 1 extracellular region 4.959008 2.154712e-10 2 extrace ...
R written 12 weeks ago by saamar.rajput20 • updated 11 weeks ago by SMK1.8k
0
votes
1
answer
160
views
1
answers
Comment: C: Color bars from ggplot on p-values
... Thanks a lot, i tried this too before but somehow it didn't work that time but now it works :) ...
written 12 weeks ago by saamar.rajput20
5
votes
1
answer
160
views
1
answer
Color bars from ggplot on p-values
... I am trying to make a bar plot, the length of which is the percentage of genes in a GO term and I would like to color the bars corresponding to the range of their p-values. My data looks like this: head(Up_Down) GO Percentage q.val 1 extracellular region ...
R written 12 weeks ago by saamar.rajput20 • updated 12 weeks ago by SMK1.8k
0
votes
3
answers
298
views
3
answers
Comment: C: Label selected genes in volcano plot from ggplot
... Thank you very much, I will keep in mind the things you pointed out :) ...
written 3 months ago by saamar.rajput20
0
votes
3
answers
298
views
3
answers
Comment: C: Label selected genes in volcano plot from ggplot
... Thank you so much :) ...
written 3 months ago by saamar.rajput20
0
votes
3
answers
298
views
3
answers
Comment: C: Label selected genes in volcano plot from ggplot
... Thank you so much. It worked !! ...
written 3 months ago by saamar.rajput20
8
votes
3
answers
298
views
3
answers
Label selected genes in volcano plot from ggplot
... I have a data frame with the differentially expressed genes from EdgeR, Now I am trying to make a volcano plot of it but I want to see only selected genes that are of interest to me to be labelled on the volcano plot. My data frame looks like this head(results) Gene Fold pval ...
R ggplot2 volcano plot written 3 months ago by saamar.rajput20 • updated 12 weeks ago by zx87548.0k
1
vote
0
answers
521
views
0
answers
Extract gene location and gene name from bed file for FASTA file
... I have 2 files, one fasta file and another gff file. In this way head Fasta >NC_002929.2 Bordetella pertussis Tohama I chromosome, complete genome ATGGATTTTCCCCGCGAATTTGATGTGATCGTCGTTGGTGGCGGTCACGCCGGTACGGAGGCAGCCCTGGCTGCAGCCCG CGCCGGCGCACAGACATTGC ...
genome sequence rna-seq written 10 months ago by saamar.rajput20
0
votes
0
answers
392
views
0
answers
Comment: C: Human genes correlation to Bacterial genes
... To identify bacterial and human genes with similar expression kinetics ...
written 16 months ago by saamar.rajput20

Latest awards to saamar.rajput

Popular Question 10 weeks ago, created a question with more than 1,000 views. For Distance Between Peaks in Macs Peak-calling data
Popular Question 10 weeks ago, created a question with more than 1,000 views. For FDR and Pvalue in EdgeR
Popular Question 10 months ago, created a question with more than 1,000 views. For Distance Between Peaks in Macs Peak-calling data
Popular Question 10 months ago, created a question with more than 1,000 views. For Constant layout orientation in igraph
Popular Question 10 months ago, created a question with more than 1,000 views. For FDR and Pvalue in EdgeR
Popular Question 16 months ago, created a question with more than 1,000 views. For Constant layout orientation in igraph
Supporter 23 months ago, voted at least 25 times.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1601 users visited in the last hour