User: saamar.rajput

gravatar for saamar.rajput
Reputation:
10
Status:
New User
Location:
Germany
Last seen:
4 months, 4 weeks ago
Joined:
3 years, 5 months ago
Email:
s************@gmail.com

Posts by saamar.rajput

<prev • 33 results • page 1 of 4 • next >
1
vote
0
answers
329
views
0
answers
Extract gene location and gene name from bed file for FASTA file
... I have 2 files, one fasta file and another gff file. In this way head Fasta >NC_002929.2 Bordetella pertussis Tohama I chromosome, complete genome ATGGATTTTCCCCGCGAATTTGATGTGATCGTCGTTGGTGGCGGTCACGCCGGTACGGAGGCAGCCCTGGCTGCAGCCCG CGCCGGCGCACAGACATTGC ...
genome sequence rna-seq written 5 months ago by saamar.rajput10
0
votes
0
answers
322
views
0
answers
Comment: C: Human genes correlation to Bacterial genes
... To identify bacterial and human genes with similar expression kinetics ...
written 11 months ago by saamar.rajput10
0
votes
0
answers
322
views
0
answers
Comment: C: Human genes correlation to Bacterial genes
... I am trying to correlate every single human gene with every single bacterial gene by pearson correlation using the the read counts of the genes. ...
written 11 months ago by saamar.rajput10
0
votes
0
answers
322
views
0
answers
Human genes correlation to Bacterial genes
... I have read counts for RNAseq data for human and bacteria with three replicates each. I have transformed the absolute read counts to Z-scores and now I want to do correlation analysis between the Z-scores of the human genes and the bacterial genes. My data looks like this head(Human) ...
gene R next-gen rna-seq written 11 months ago by saamar.rajput10
2
votes
1
answer
487
views
1
answer
Locate Kegg Pathways from my network
... I am working on big networks of genes. I want to locate KEGG/Reactome pathways in my network. I have already tried cytoKegg and ReactomeFI (Plugins of Cytoscape), they only give me a list of Pathways with the genes in it. But I want to visually see the grouped genes from my network which belong to ...
gene R written 13 months ago by saamar.rajput10 • updated 13 months ago by Jean-Karim Heriche18k
0
votes
0
answers
388
views
0
answers
Reactome Pathway Analysis from command line
... I have a list of genes or may be a file containing a list of genes. I want to see the pathways from Reactome that are enriched with the gene list i have (not just a list of pathway but the visualization from the Reactome Pathway database), But I want to do this by a command line. Is it possible ? I ...
gene rna-seq written 14 months ago by saamar.rajput10
2
votes
2
answers
1.5k
views
2
answers
FDR and Pvalue in EdgeR
... I am doing differential expression analysis on my data. I am getting all the results i want except for the FDR value. I want to know both the pvalue for the gene and the adjp for the gene. How to get that ? here is my code and my result exprs <- as.matrix(read.table(exprsFile, header ...
R rna-seq written 18 months ago by saamar.rajput10 • updated 15 months ago by Marks40
0
votes
0
answers
426
views
0
answers
(Closed) Adding shot Noise to RNAseq counts
... I want to add Shot Noise in my RNAseq counts data, does anybody know how to do that? ...
rna-seq written 18 months ago by saamar.rajput10
0
votes
0
answers
682
views
0
answers
Comment: C: Inserting Noise into RNA-seq raw counts
... What do you suggest then? ...
written 18 months ago by saamar.rajput10
1
vote
0
answers
682
views
0
answers
Inserting Noise into RNA-seq raw counts
... I have a RNA-seq raw counts data and I want to test a software for which i want to compare the results of data with noise and data without noise in the counts. For this i need to add some noise into my RNA-seq raw counts data. Can somebody suggest how to add noise into my data at the transcript cou ...
next-gen rna-seq written 18 months ago by saamar.rajput10

Latest awards to saamar.rajput

Popular Question 5 months ago, created a question with more than 1,000 views. For FDR and Pvalue in EdgeR
Popular Question 11 months ago, created a question with more than 1,000 views. For Constant layout orientation in igraph
Supporter 18 months ago, voted at least 25 times.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1257 users visited in the last hour