User: vjmorley

gravatar for vjmorley
New User
United States
Last seen:
2 years, 11 months ago
3 years, 5 months ago

Posts by vjmorley

<prev • 8 results • page 1 of 1 • next >
Comment: C: Extracting paired unmapped reads into fastq gives empty file
... Hm, still doesn't seem to be solving the problem. I tried using a BAM file as input rather than a SAM file and changing the -u flag to a -b flag, but I'm still getting the same result. ...
written 3.0 years ago by vjmorley30
Comment: C: Extracting paired unmapped reads into fastq gives empty file
... I just gave this a try, and unfortunately using the 13 flag still gives the same incomplete fastq file for the paired reads. ...
written 3.0 years ago by vjmorley30
Comment: C: Extracting paired unmapped reads into fastq gives empty file
... Sure, here's the output: $ samtools view unmapped.bam | grep "HISEQ:242:H32LYADXX:2:1101:1272:81236" HISEQ:242:H32LYADXX:2:1101:1272:81236 77 * 0 0 * TATTNTCAAAAGATTTATTCTTTTTGACCTTTATACCAAACTGTTCAGCATATTCAGCTAATTTAGCC @@@D#2ABFDB?BGHIGIIB@?<4C:EADFEGIHGEEEIFII>DFGGEEHIGC?9DCH HIS ...
written 3.0 years ago by vjmorley30
Extracting paired unmapped reads into fastq gives empty file
... I am working with paired-end Illumina Hiseq data. My goal is to create a new set of fastq files containing only paired reads that do not map to an E. coli reference. I created an alignment to an E. coli reference, then extracted unmapped paired reads to a new file: samtools view -u -f 12 ecoli ...
next-gen alignment written 3.0 years ago by vjmorley30 • updated 2.9 years ago by Biostar ♦♦ 20
Answer: A: calculating within population nucleotide diversity for a virus population
... Update: In the end I found SNPGenie to be most useful for calculating Pi from RNA virus data. I tried PoPoolation, but found that it had trouble with the high coverage and large population sizes associated with RNA virus data. ...
written 3.0 years ago by vjmorley30
calculating within population nucleotide diversity for a virus population
... I'm interested in using my next-gen sequencing data to calculate within population nucleotide diversity in RNA virus populations. My samples were sequenced on Illumina Hiseq, and each sample represents a diverse virus population. I have come across several packages for calculating nucleotide diversi ...
metagenomics next-gen population genetics written 3.4 years ago by vjmorley30
Comment: C: bwa error: paired reads have different names
... Thanks! I used cutadapt to trim the paired reads, and that solved the problem. I really appreciate the help! ...
written 3.5 years ago by vjmorley30
bwa error: paired reads have different names
... I'm getting an error when I try to pair my reads using bwa (version 0.7.10-r789). Here's my pipeline: Trim for quality using fastx fastq_quality_trimmer >fastq_quality_trimmer -t 20 -l 30 -Q33 -i for.fastq -o for_trimmed.fastq >fastq_quality_trimmer -t 20 -l 30 -Q33 -i rev.fastq -o rev_trim ...
software error alignment written 3.5 years ago by vjmorley30 • updated 3.5 years ago by Daniel Swan13k

Latest awards to vjmorley

No awards yet. Soon to come :-)


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1144 users visited in the last hour