User: vjmorley

gravatar for vjmorley
vjmorley30
Reputation:
30
Status:
New User
Location:
United States
Last seen:
3 years, 8 months ago
Joined:
4 years, 2 months ago
Email:
v*******@gmail.com

Posts by vjmorley

<prev • 8 results • page 1 of 1 • next >
0
votes
0
answers
1.3k
views
0
answers
Comment: C: Extracting paired unmapped reads into fastq gives empty file
... Hm, still doesn't seem to be solving the problem. I tried using a BAM file as input rather than a SAM file and changing the -u flag to a -b flag, but I'm still getting the same result. ...
written 3.7 years ago by vjmorley30
0
votes
0
answers
1.3k
views
0
answers
Comment: C: Extracting paired unmapped reads into fastq gives empty file
... I just gave this a try, and unfortunately using the 13 flag still gives the same incomplete fastq file for the paired reads. ...
written 3.7 years ago by vjmorley30
1
vote
0
answers
1.3k
views
0
answers
Comment: C: Extracting paired unmapped reads into fastq gives empty file
... Sure, here's the output: $ samtools view unmapped.bam | grep "HISEQ:242:H32LYADXX:2:1101:1272:81236" HISEQ:242:H32LYADXX:2:1101:1272:81236 77 * 0 0 * TATTNTCAAAAGATTTATTCTTTTTGACCTTTATACCAAACTGTTCAGCATATTCAGCTAATTTAGCC @@@D#2ABFDB?BGHIGIIB@?<4C:EADFEGIHGEEEIFII>DFGGEEHIGC?9DCH HIS ...
written 3.7 years ago by vjmorley30
1
vote
0
answers
1.3k
views
0
answers
Extracting paired unmapped reads into fastq gives empty file
... I am working with paired-end Illumina Hiseq data. My goal is to create a new set of fastq files containing only paired reads that do not map to an E. coli reference. I created an alignment to an E. coli reference, then extracted unmapped paired reads to a new file: samtools view -u -f 12 ecoli ...
next-gen alignment written 3.7 years ago by vjmorley30 • updated 3.6 years ago by Biostar ♦♦ 20
0
votes
3
answers
2.8k
views
3
answers
Answer: A: calculating within population nucleotide diversity for a virus population
... Update: In the end I found SNPGenie to be most useful for calculating Pi from RNA virus data. I tried PoPoolation, but found that it had trouble with the high coverage and large population sizes associated with RNA virus data. ...
written 3.7 years ago by vjmorley30
1
vote
3
answers
2.8k
views
3
answers
calculating within population nucleotide diversity for a virus population
... I'm interested in using my next-gen sequencing data to calculate within population nucleotide diversity in RNA virus populations. My samples were sequenced on Illumina Hiseq, and each sample represents a diverse virus population. I have come across several packages for calculating nucleotide diversi ...
metagenomics next-gen population genetics written 4.1 years ago by vjmorley30
1
vote
1
answer
4.6k
views
1
answers
Comment: C: bwa error: paired reads have different names
... Thanks! I used cutadapt to trim the paired reads, and that solved the problem. I really appreciate the help! ...
written 4.2 years ago by vjmorley30
4
votes
1
answer
4.6k
views
1
answer
bwa error: paired reads have different names
... I'm getting an error when I try to pair my reads using bwa (version 0.7.10-r789). Here's my pipeline: Trim for quality using fastx fastq_quality_trimmer >fastq_quality_trimmer -t 20 -l 30 -Q33 -i for.fastq -o for_trimmed.fastq >fastq_quality_trimmer -t 20 -l 30 -Q33 -i rev.fastq -o rev_trim ...
software error alignment written 4.2 years ago by vjmorley30 • updated 4.2 years ago by Daniel Swan13k

Latest awards to vjmorley

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1516 users visited in the last hour