User: Lila M

gravatar for Lila M
Lila M 460
Reputation:
460
Status:
Trusted
Location:
UK
Last seen:
2 days, 4 hours ago
Joined:
3 years, 5 months ago
Email:
p*************@gmail.com

Posts by Lila M

<prev • 286 results • page 1 of 29 • next >
0
votes
0
answers
70
views
0
answers
Comment: C: what is the best way to calculate significant differences in tss profiles?
... Hi, there are no replicates, they are ChiP-seq samples in different conditions. ...
written 6 days ago by Lila M 460
1
vote
0
answers
70
views
0
answers
what is the best way to calculate significant differences in tss profiles?
... Hi everybody, I have different samples that I used to calculate the coverage over specific data set. I did it using deeptools, so my final output is something like this s1 1,923575916 1,92340092 1,918008392 1,915392666 ... s2 1,993446863 1,931309701 1,925363124 1,935658019 ... s3 2,034 ...
differences coverage tss written 6 days ago by Lila M 460 • updated 6 days ago by ATpoint14k
1
vote
0
answers
102
views
0
answers
Comment: C: How to calculate read depth for a specific gene list?
... Hi Kevin, Thank you for such an extensive response! What I basically did , was to transform my bam file into a bed one, so then I was able to get the coverage by running bedtools coverage -a file.bed -b file.bedGraph -counts > coverage_by_counts ...
written 5 weeks ago by Lila M 460
0
votes
0
answers
102
views
0
answers
Comment: C: How to calculate read depth for a specific gene list?
... Hi, the chromosomes appeared as "chr1" SRR6497149.3455795 16 chr1 10533 1 65M * 0 0AAGTACCACCGAAATCTGTGCAGAGGAGAACGCAGCTCCGCCCTCGCGGTGCTCTCCGGGTCTGT EGGGGFGGGGGGEGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGDGGGGGGGGFGGFGGGEBBBBB AS:i:-10 XS:i:-10 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:0G26C37 YT:Z:UU howev ...
written 5 weeks ago by Lila M 460
2
votes
0
answers
102
views
0
answers
How to calculate read depth for a specific gene list?
... Hi everybody, I'm stuck in the middle of something. I have a selected gene list `(bed file`) like this: chr start end strand gene geneLength chr1 185217 195411 - ENSG00000279457 10194 chr1 725885 778626 - ENSG00000228327 52741 chr1 725885 778626 - ENSG00000228327 ...
readdepth interesct coverage written 5 weeks ago by Lila M 460
0
votes
0
answers
95
views
0
answers
Comment: C: how to plot a TSS profile using an external quantification for Watson and Crick
... Sorry but I can't figure out how to do it with those programs, more help will be very handy! Thanks! ...
written 6 weeks ago by Lila M 460
0
votes
0
answers
95
views
0
answers
Comment: C: how to plot a TSS profile using an external quantification for Watson and Crick
... Thank you for the tip, but as far as I understand, deeptools needs the bam files or bigwig files (I only have this bed file to work with). I will have a look into genomation as I never work with it before. ...
written 6 weeks ago by Lila M 460
0
votes
0
answers
95
views
0
answers
how to plot a TSS profile using an external quantification for Watson and Crick strand
... Hi everybody, I have an issue here, let's say I have this kind of data: chr w_start w_end ratio_w ratio_c chr txt_start txt_end strand gene chr1 879000 879999 0.102 0.306 chr1 879584 882440 - ENSG00000188976 chr1 879000 879999 0.102 0.306 chr1 879584 894670 - ...
ggplot ratio coverage tss written 6 weeks ago by Lila M 460
2
votes
1
answer
186
views
1
answers
Comment: C: error while reading bigwig files in computeMatrix (deeptools)
... I find the silly problem, I forgot to transform the bedGraph after merging using `bedGraphToBigWig` ...
written 7 weeks ago by Lila M 460
0
votes
1
answer
186
views
1
answers
Comment: C: error while reading bigwig files in computeMatrix (deeptools)
... The file that I started with is a wig file like this: GSM2936611_BJ.c.a_merged_coverage_strand-_scaled_bin10_EXT0.copy2_lane2_rep1.wig.gz track type=wiggle_0 name=BJ.c.a.- description=BJ.c.a.- maxHeightPixels=50:30:11 color=150,50,110 alwaysZero=on variableStep chrom=chr1 ...
written 7 weeks ago by Lila M 460

Latest awards to Lila M

Popular Question 24 days ago, created a question with more than 1,000 views. For how to create a minimun spanning tree with R
Popular Question 24 days ago, created a question with more than 1,000 views. For How to convert bedgraph to bigwig?
Popular Question 24 days ago, created a question with more than 1,000 views. For which option is better for DESeq2 analysis: salmon or htseq-count?
Popular Question 5 weeks ago, created a question with more than 1,000 views. For how to create a minimun spanning tree with R
Popular Question 5 weeks ago, created a question with more than 1,000 views. For how to create a minimun spanning tree with R
Popular Question 6 weeks ago, created a question with more than 1,000 views. For how to create a minimun spanning tree with R
Popular Question 7 weeks ago, created a question with more than 1,000 views. For how to create a minimun spanning tree with R
Popular Question 7 weeks ago, created a question with more than 1,000 views. For how to create a minimun spanning tree with R
Student 7 weeks ago, asked a question with at least 3 up-votes. For should I merge fastq files for different lanes before do QC?
Popular Question 7 weeks ago, created a question with more than 1,000 views. For how to create a minimun spanning tree with R
Popular Question 8 weeks ago, created a question with more than 1,000 views. For how to create a minimun spanning tree with R
Great Question 4 months ago, created a question with more than 5,000 views. For How to convert bedgraph to bigwig?
Popular Question 4 months ago, created a question with more than 1,000 views. For how to create a minimun spanning tree with R
Popular Question 5 months ago, created a question with more than 1,000 views. For how to create a minimun spanning tree with R
Popular Question 6 months ago, created a question with more than 1,000 views. For how to create a minimun spanning tree with R
Popular Question 6 months ago, created a question with more than 1,000 views. For how to create a minimun spanning tree with R
Popular Question 6 months ago, created a question with more than 1,000 views. For How to convert bedgraph to bigwig?
Popular Question 7 months ago, created a question with more than 1,000 views. For how to create a minimun spanning tree with R
Popular Question 7 months ago, created a question with more than 1,000 views. For how to create a minimun spanning tree with R
Popular Question 7 months ago, created a question with more than 1,000 views. For How to convert bedgraph to bigwig?
Popular Question 7 months ago, created a question with more than 1,000 views. For how to compare 2 fasta sequences with perl
Popular Question 14 months ago, created a question with more than 1,000 views. For How to convert bedgraph to bigwig?
Popular Question 14 months ago, created a question with more than 1,000 views. For Looking for a ClueGO (cytoscape) tutorial
Popular Question 14 months ago, created a question with more than 1,000 views. For how to compare 2 fasta sequences with perl
Popular Question 14 months ago, created a question with more than 1,000 views. For should I merge fastq files for different lanes before do QC?

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 942 users visited in the last hour