User: Lila M

gravatar for Lila M
Lila M 370
Reputation:
370
Status:
Trusted
Location:
UK
Last seen:
2 days, 1 hour ago
Joined:
2 years, 1 month ago
Email:
p*************@gmail.com

Posts by Lila M

<prev • 207 results • page 1 of 21 • next >
0
votes
0
answers
111
views
0
answers
Comment: C: Error when run testForDEU DEXSeq
... Yes, I called it in that order, and the error appear after dsd = testForDEU(dsd) ...
written 19 days ago by Lila M 370
0
votes
0
answers
111
views
0
answers
Comment: C: Error when run testForDEU DEXSeq
... I forgot to include it in the code, but I've called it as well, thanks! ...
written 19 days ago by Lila M 370
2
votes
0
answers
111
views
0
answers
Error when run testForDEU DEXSeq
... Hie everybody, I have this error when I've tried to run `dsd = testForDEU(dsd)` Error in (function (classes, fdef, mtable) : unable to find an inherited method for function ‘sizeFactors’ for signature ‘"list"’ My complete code is: meta <- read.delim(file.path("meta"), header=T ...
dexseq rnaseq error deu written 19 days ago by Lila M 370
0
votes
1
answer
135
views
1
answers
Comment: C: Problem with Ensembl version identifiers after running DESeq2
... Because the counts where done using salmon and the original files included the identifiers with the dot, so I don't know if I have to remove it from the original files or there is other way to do that... because the ID with the dot are not recognized. ...
written 24 days ago by Lila M 370
3
votes
1
answer
135
views
1
answer
Problem with Ensembl version identifiers after running DESeq2
... Hi everybody, I have a problem with my Ensembl ID after running DESEq2 (I'm using hg38 genome): dds <- DESeq(ds_matrix) res <- results(dds) baseMean log2FoldChange lfcSE stat pvalue padj ENSG00000176124.11 168.67880 4.991104 0 ...
ensembl deseq2 identifiers annotation written 24 days ago by Lila M 370
0
votes
1
answer
162
views
1
answers
Comment: A: how to remove Overrepresented sequences for paired end with cutadapt?
... If someone else has the same issue, I would like to add more information. If you are planning to map the sequences with STAR, for example, you may have an error like `EXITING because of FATAL ERROR in reads input: short read sequence line` . It can be solved if you add the parameter `-m N`, in my ca ...
written 26 days ago by Lila M 370
0
votes
1
answer
162
views
1
answers
Comment: C: how to remove Overrepresented sequences for paired end with cutadapt?
... Thank you very much! ...
written 26 days ago by Lila M 370
3
votes
1
answer
162
views
1
answer
how to remove Overrepresented sequences for paired end with cutadapt?
... Hi guys, I have a question. After running fasqc, I've discovered that some of my reads has overrepresnted sequences as follow fastq.R1 Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA 141860 0.4972976921930607 TruSeq A ...
trimming fastqc paired-end rna-seq cutadapt written 26 days ago by Lila M 370
0
votes
0
answers
128
views
0
answers
is necessary to remove TruSeq index adapter with low percent and present in one read?
... Hi everybody, I have paired end data, after running fastqc I found some over represented sequences from TruSeq Index Adapter (less than 0.6%) but when I've found them, are only present in one read. The adapter content looks perfect. I was wondering if is necessary to remove it when is only present ...
adapters paired-end quality control rna-seq written 27 days ago by Lila M 370
1
vote
2
answers
198
views
2
answers
Answer: A: error when run tximport for salmon files
... problem solved! Thanks! ...
written 5 weeks ago by Lila M 370

Latest awards to Lila M

Voter 26 days ago, voted more than 100 times.
Popular Question 3 months ago, created a question with more than 1,000 views. For how to compare 2 fasta sequences with perl
Popular Question 3 months ago, created a question with more than 1,000 views. For How to convert bedgraph to bigwig?
Scholar 6 months ago, created an answer that has been accepted. For A: How to plot a heat map for the top 30 differentially expressed genes.
Centurion 8 months ago, created 100 posts.
Supporter 8 months ago, voted at least 25 times.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 878 users visited in the last hour