User: Vanilla

gravatar for Vanilla
Vanilla80
Reputation:
80
Status:
Trusted
Location:
Hong Kong
Last seen:
1 month ago
Joined:
4 years, 7 months ago
Email:
y********@gmail.com

Posts by Vanilla

<prev • 17 results • page 1 of 2 • next >
0
votes
3
answers
3.6k
views
3
answers
Answer: C: macs2 bdgdiff calculation without genomic background control?
... For the question "how does `macs2` generate the `b3tTime0_control_lambda.bdg`", I found the answer here: https://groups.google.com/forum/#!msg/macs-announcement/9N-sMFc8784/SxlSU8joSkwJ. In brief, MACS2 estimates control lambda from the ChIP sample itself when the control sample is absent. ...
written 19 months ago by Vanilla80
0
votes
1
answer
1.4k
views
1
answers
Comment: C: ENCODE ChIP-Seq Control Experiments
... Now the`'possible_controls'` has been changed to `'Controlled by'`. ...
written 20 months ago by Vanilla80
0
votes
1
answer
784
views
1
answers
Comment: C: DEG detection with datasets generated with different sequencing protocol
... Got it. Thanks Santosh! ...
written 2.4 years ago by Vanilla80
0
votes
1
answer
784
views
1
answers
Comment: C: DEG detection with datasets generated with different sequencing protocol
... What if I only have FPKM values? Could I take log of them and remove low expressed genes (to make the distribution approximate to normal)? ...
written 2.4 years ago by Vanilla80
0
votes
1
answer
784
views
1
answers
Comment: C: DEG detection with datasets generated with different sequencing protocol
... Thanks Santosh! Would DESeq2 accept FPKM values as input? Or only raw read count? ...
written 2.4 years ago by Vanilla80
3
votes
1
answer
784
views
1
answer
DEG detection with datasets generated with different sequencing protocol
... Hi all! I'm going to detect differentially expressed genes with RNA-seq data got from some "GFP positive cells" and "GFP negative cells". However, the cDNA are sequenced with two different methods, one as "normal" RNA-seq, and the other is low-input RNA-seq (only requires a small amount of starting ...
degs rna-seq statistics written 2.4 years ago by Vanilla80 • updated 2.4 years ago by Santosh Anand5.1k
1
vote
0
answers
1.2k
views
0
answers
How to deal with low-depth ChIP-seq / ATAC-seq samples
... Hi all! I got several ATAC-seq and ChIP-seq samples, but unfortunately, some of them are with low sequencing depth after I trimmed the reads with mapping quality, duplicates, and mitochondrial DNA and keep proper paired (it's paired end reads). Only a few peaks can be called for them and it's hard ...
normalization chip-seq atac-seq low depth written 3.0 years ago by Vanilla80
0
votes
1
answer
3.0k
views
1
answers
Comment: C: Difference between chimeric alignments and multiple mapping
... Got it. Thanks very much for your help Devon! ...
written 3.0 years ago by Vanilla80
0
votes
1
answer
3.0k
views
1
answers
Comment: C: Difference between chimeric alignments and multiple mapping
... Got it. So I will also just throw them away. In case you also have secondary alignments from multiple mapping(e.g. due to repeat sequences), should them also be discarded for ChIP-seq analysis? I'm also curious why I didn't get any of secondary alignments. ...
written 3.0 years ago by Vanilla80
0
votes
1
answer
3.0k
views
1
answers
Comment: C: Difference between chimeric alignments and multiple mapping
... Thanks Devon! I agree as just checked that this is a repeat "ACACACATATACACAGTGCTAAGTTCATTGT" around chr6:144444722 on mm10, which causes the multiple alignments for the reads. Oh I also have a lot of cases with supplementary alignments mapped elsewhere, with sequence overlaps but not genome coor ...
written 3.0 years ago by Vanilla80 • updated 3.0 years ago by Devon Ryan95k

Latest awards to Vanilla

Popular Question 19 months ago, created a question with more than 1,000 views. For How to deal with low-depth ChIP-seq / ATAC-seq samples
Appreciated 20 months ago, created a post with more than 5 votes. For Difference between chimeric alignments and multiple mapping
Good Question 20 months ago, asked a question that was upvoted at least 5 times. For Difference between chimeric alignments and multiple mapping
Popular Question 2.4 years ago, created a question with more than 1,000 views. For How is "integer score for display" calculated in MACS2
Popular Question 2.4 years ago, created a question with more than 1,000 views. For Difference between chimeric alignments and multiple mapping
Popular Question 2.4 years ago, created a question with more than 1,000 views. For genomeCoverageBed for paired end reads
Student 2.4 years ago, asked a question with at least 3 up-votes. For Difference between chimeric alignments and multiple mapping

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1896 users visited in the last hour