User: Vanilla

gravatar for Vanilla
Vanilla80
Reputation:
80
Status:
Trusted
Location:
Hong Kong
Last seen:
3 weeks ago
Joined:
3 years ago
Email:
y********@gmail.com

Posts by Vanilla

<prev • 17 results • page 1 of 2 • next >
0
votes
2
answers
2.5k
views
2
answers
Answer: C: macs2 bdgdiff calculation without genomic background control?
... For the question "how does `macs2` generate the `b3tTime0_control_lambda.bdg`", I found the answer here: https://groups.google.com/forum/#!msg/macs-announcement/9N-sMFc8784/SxlSU8joSkwJ. In brief, MACS2 estimates control lambda from the ChIP sample itself when the control sample is absent. ...
written 5 weeks ago by Vanilla80
0
votes
1
answer
867
views
1
answers
Comment: C: ENCODE ChIP-Seq Control Experiments
... Now the`'possible_controls'` has been changed to `'Controlled by'`. ...
written 8 weeks ago by Vanilla80
0
votes
1
answer
400
views
1
answers
Comment: C: DEG detection with datasets generated with different sequencing protocol
... Got it. Thanks Santosh! ...
written 10 months ago by Vanilla80
0
votes
1
answer
400
views
1
answers
Comment: C: DEG detection with datasets generated with different sequencing protocol
... What if I only have FPKM values? Could I take log of them and remove low expressed genes (to make the distribution approximate to normal)? ...
written 10 months ago by Vanilla80
0
votes
1
answer
400
views
1
answers
Comment: C: DEG detection with datasets generated with different sequencing protocol
... Thanks Santosh! Would DESeq2 accept FPKM values as input? Or only raw read count? ...
written 10 months ago by Vanilla80
3
votes
1
answer
400
views
1
answer
DEG detection with datasets generated with different sequencing protocol
... Hi all! I'm going to detect differentially expressed genes with RNA-seq data got from some "GFP positive cells" and "GFP negative cells". However, the cDNA are sequenced with two different methods, one as "normal" RNA-seq, and the other is low-input RNA-seq (only requires a small amount of starting ...
degs rna-seq statistics written 10 months ago by Vanilla80 • updated 10 months ago by Santosh Anand4.2k
1
vote
0
answers
751
views
0
answers
How to deal with low-depth ChIP-seq / ATAC-seq samples
... Hi all! I got several ATAC-seq and ChIP-seq samples, but unfortunately, some of them are with low sequencing depth after I trimmed the reads with mapping quality, duplicates, and mitochondrial DNA and keep proper paired (it's paired end reads). Only a few peaks can be called for them and it's hard ...
normalization chip-seq atac-seq low depth written 17 months ago by Vanilla80
0
votes
1
answer
1.4k
views
1
answers
Comment: C: Difference between chimeric alignments and multiple mapping
... Got it. Thanks very much for your help Devon! ...
written 17 months ago by Vanilla80
0
votes
1
answer
1.4k
views
1
answers
Comment: C: Difference between chimeric alignments and multiple mapping
... Got it. So I will also just throw them away. In case you also have secondary alignments from multiple mapping(e.g. due to repeat sequences), should them also be discarded for ChIP-seq analysis? I'm also curious why I didn't get any of secondary alignments. ...
written 17 months ago by Vanilla80
0
votes
1
answer
1.4k
views
1
answers
Comment: C: Difference between chimeric alignments and multiple mapping
... Thanks Devon! I agree as just checked that this is a repeat "ACACACATATACACAGTGCTAAGTTCATTGT" around chr6:144444722 on mm10, which causes the multiple alignments for the reads. Oh I also have a lot of cases with supplementary alignments mapped elsewhere, with sequence overlaps but not genome coor ...
written 17 months ago by Vanilla80 • updated 17 months ago by Devon Ryan86k

Latest awards to Vanilla

Appreciated 8 weeks ago, created a post with more than 5 votes. For Difference between chimeric alignments and multiple mapping
Good Question 8 weeks ago, asked a question that was upvoted at least 5 times. For Difference between chimeric alignments and multiple mapping
Popular Question 9 months ago, created a question with more than 1,000 views. For How is "integer score for display" calculated in MACS2
Popular Question 9 months ago, created a question with more than 1,000 views. For Difference between chimeric alignments and multiple mapping
Popular Question 9 months ago, created a question with more than 1,000 views. For genomeCoverageBed for paired end reads
Student 9 months ago, asked a question with at least 3 up-votes. For Difference between chimeric alignments and multiple mapping

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1574 users visited in the last hour