User: Vanilla

gravatar for Vanilla
Vanilla50
Reputation:
50
Status:
New User
Location:
Hong Kong
Last seen:
4 months ago
Joined:
2 years, 6 months ago
Email:
y********@gmail.com

Posts by Vanilla

<prev • 15 results • page 1 of 2 • next >
0
votes
1
answer
273
views
1
answers
Comment: C: DEG detection with datasets generated with different sequencing protocol
... Got it. Thanks Santosh! ...
written 4 months ago by Vanilla50
0
votes
1
answer
273
views
1
answers
Comment: C: DEG detection with datasets generated with different sequencing protocol
... What if I only have FPKM values? Could I take log of them and remove low expressed genes (to make the distribution approximate to normal)? ...
written 4 months ago by Vanilla50
0
votes
1
answer
273
views
1
answers
Comment: C: DEG detection with datasets generated with different sequencing protocol
... Thanks Santosh! Would DESeq2 accept FPKM values as input? Or only raw read count? ...
written 4 months ago by Vanilla50
3
votes
1
answer
273
views
1
answer
DEG detection with datasets generated with different sequencing protocol
... Hi all! I'm going to detect differentially expressed genes with RNA-seq data got from some "GFP positive cells" and "GFP negative cells". However, the cDNA are sequenced with two different methods, one as "normal" RNA-seq, and the other is low-input RNA-seq (only requires a small amount of starting ...
degs rna-seq statistics written 4 months ago by Vanilla50 • updated 4 months ago by Santosh Anand3.5k
1
vote
0
answers
523
views
0
answers
How to deal with low-depth ChIP-seq / ATAC-seq samples
... Hi all! I got several ATAC-seq and ChIP-seq samples, but unfortunately, some of them are with low sequencing depth after I trimmed the reads with mapping quality, duplicates, and mitochondrial DNA and keep proper paired (it's paired end reads). Only a few peaks can be called for them and it's hard ...
normalization chip-seq atac-seq low depth written 11 months ago by Vanilla50
0
votes
1
answer
871
views
1
answers
Comment: C: Difference between chimeric alignments and multiple mapping
... Got it. Thanks very much for your help Devon! ...
written 11 months ago by Vanilla50
0
votes
1
answer
871
views
1
answers
Comment: C: Difference between chimeric alignments and multiple mapping
... Got it. So I will also just throw them away. In case you also have secondary alignments from multiple mapping(e.g. due to repeat sequences), should them also be discarded for ChIP-seq analysis? I'm also curious why I didn't get any of secondary alignments. ...
written 11 months ago by Vanilla50
0
votes
1
answer
871
views
1
answers
Comment: C: Difference between chimeric alignments and multiple mapping
... Thanks Devon! I agree as just checked that this is a repeat "ACACACATATACACAGTGCTAAGTTCATTGT" around chr6:144444722 on mm10, which causes the multiple alignments for the reads. Oh I also have a lot of cases with supplementary alignments mapped elsewhere, with sequence overlaps but not genome coor ...
written 11 months ago by Vanilla50 • updated 11 months ago by Devon Ryan79k
7
votes
1
answer
871
views
1
answer
Difference between chimeric alignments and multiple mapping
... Hi all: I recently got quite confused with two SAM flags got from BWA alignment, which is "**supplementary alignment**" from chimeric alignments and "**not primary alignment**" (or "secondary alignment") from multiple mapping. **What samtools explain about these two flags is:** (Refer to https://s ...
sam flag alignment samtools sam sequencing written 11 months ago by Vanilla50 • updated 11 months ago by Devon Ryan79k
0
votes
1
answer
1.3k
views
1
answers
Comment: C: How is "integer score for display" calculated in MACS2
... Hi Igor, Thanks very much for your answer. Actually their explanation is still vague, and I still didn't get how this score can reflect how strong the peak is. But anyway, as they suggested using column7-9 for downstream, I may only take this score for visualization but not used for filtering. Th ...
written 20 months ago by Vanilla50

Latest awards to Vanilla

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 735 users visited in the last hour