User: kenneth.jh.han

Reputation:
0
Status:
New User
Last seen:
1 year, 4 months ago
Joined:
3 years, 9 months ago
Email:
k*************@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by kenneth.jh.han

<prev • 3 results • page 1 of 1 • next >
0
votes
0
answers
1.2k
views
0
answers
Are there any tools like "Somatic variation Viewer" ? (like IGV)
... Hi I was wondering about if there are tools like IGV on "Somatic Variation".. Thanks ...
sv viewer somatic variation igv written 3.7 years ago by kenneth.jh.han0
3
votes
3
answers
910
views
3
answers
rosalind.info not working?
... Does anyone know the reason why the site www.rosalind.info not working for 6 hours? It keeps saying  500 — Bad Code GACCCAGCAATGACGTATACAGGGCTTAAT CTGGGTCGTTACCGCATATGTACCGAATTA We'll patch this code soon. Please try again later or compile another code. ...
rosalind written 3.8 years ago by kenneth.jh.han0 • updated 3.8 years ago by genomax70k
0
votes
2
answers
1.3k
views
2
answers
Between mm10.p4 and mm10, why the total sequence length different?
... Hi, My name is Kenneth. I found that mm10.p4 and mm10 the total length of sequence is different in websites. (NCBI, Ensembl ..)   http://www.ebi.ac.uk/ena/data/view/GCA_000001635.6 http://www.ncbi.nlm.nih.gov/assembly/GCF_000001635.24 http://www.ncbi.nlm.nih.gov/assembly/327618 --------------- ...
genome assembly mm10 reference mouse written 3.8 years ago by kenneth.jh.han0 • updated 2.1 years ago by Biostar ♦♦ 20

Latest awards to kenneth.jh.han

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 856 users visited in the last hour