User: sebastien.letort

Reputation:
50
Status:
New User
Location:
France
Last seen:
2 weeks, 1 day ago
Joined:
2 years, 8 months ago
Email:
s***************@irisa.fr

Posts by sebastien.letort

<prev • 17 results • page 1 of 2 • next >
0
votes
1
answer
128
views
1
answers
Comment: A: DSK: readme and options
... Okay, my mistake. This is clearly not the place to report this problem. Sorry and thanks for not being rough ;) ...
written 29 days ago by sebastien.letort50
6
votes
1
answer
128
views
1
answer
DSK: readme and options
... dsk readme shows command line with -file and -kmer-size. The one I used (no --version, so don't know which) on genouest.org cluster doesn't understand those options. It seems to be only dsk file_in kmer_size. So time for you to update the readme or for me to update dsk ? ...
gatb written 29 days ago by sebastien.letort50 • updated 28 days ago by pierre.peterlongo820
0
votes
0
answers
237
views
0
answers
Comment: C: blastn error values meaning
... So, I isolated the sequence that pose bp (at least one sequence). https://data-access.cesgo.org/index.php/s/drp18eXmrj1a5lL I ran blaster on it -> error value 9 I ran blastn => no error. I'm not used to blaster and not really to blast, so I used the following option conversion : blaster ...
written 4 months ago by sebastien.letort50
0
votes
0
answers
237
views
0
answers
Comment: C: blastn error values meaning
... Yes (how do you know ?) but the error occur also if I run the blaster command alone. I blast chunks of the fasta file to seek for the bad sequence. ...
written 4 months ago by sebastien.letort50
1
vote
0
answers
237
views
0
answers
blastn error values meaning
... Hi, my blast command ends with an error value 9 and I can't find the meaning of it. Can someone give me a clue on what went wrong ? blaster -n blastn -q Boleracea_db/batches/batch_244.fa -s Boleracea_db/Boleracea_chunks.fa -B debug_batch_244.fa -a -S 0 -E 1e-300 -L 100 -I 90 -N -p '-a 1 ' -c - ...
blast error written 4 months ago by sebastien.letort50 • updated 4 months ago by callum_heath0
1
vote
1
answer
469
views
1
answers
Answer: A: CWL: WorkflowException: 'location'
... The error seems to come from the yaml file used as input. The following command works cwl-runner nucmer.cwl --query test.ref.fa --reference test.ref.fa --- Ok I've found what's wrong. Class is 'File' and not 'file'. I suggest to have a more precise output error message. "*No class 'file' exis ...
written 15 months ago by sebastien.letort50
0
votes
1
answer
469
views
1
answers
Comment: C: CWL: WorkflowException: 'location'
... They are both fasta files, they exist and the nucmer command alone works well. test.in.fa, 50 seq, 2 lines per seq >scaffold_1 TTTTATTTATTTCTTTTTATCTTTTAATTTTAAAAAATAATATAATTTGACAATATTTTGTTTCTTTTTTTAAAAGATATCGAATATGAAATAATACAATCCTATTGGTTGGTGAACTTAGAGGTTCACCCTAGGAGGTGAACCCAAGAAAAAGTCTTTTG ...
written 15 months ago by sebastien.letort50
0
votes
2
answers
425
views
2
answers
Answer: A: cwl stderr management: Not all output in my outfile.
... I'll accept the answer as it provided valuable clue to start a description. But I mention that this description (or my use of it !) leads to [another error][1] : workflowException: 'location' [1]: https://www.biostars.org/p/245340/ ...
written 15 months ago by sebastien.letort50
2
votes
1
answer
469
views
1
answer
CWL: WorkflowException: 'location'
... Hi there, Following my previous [post][1] about nucmer description (as my first real prog description), I tried the solution proprosed by Mickael, but I have now another problem. The command nucmer test.ref.fa test.in.fa works fine, but with cwl tool I got a workflow error. Traceback (m ...
cwl exception output nucmer written 15 months ago by sebastien.letort50
1
vote
2
answers
425
views
2
answers
cwl stderr management: Not all output in my outfile.
... Hi, it's a noob question. I'm practicing cwl with Nucmer software http://mummer.sourceforge.net/manual/#nucmer. I have described only the help and version argument with : cwlVersion: v1.0 class: CommandLineTool baseCommand: nucmer inputs: help: type: "null" ...
stderr cwl written 15 months ago by sebastien.letort50

Latest awards to sebastien.letort

Scholar 15 months ago, created an answer that has been accepted. For A: CWL: WorkflowException: 'location'
Student 2.6 years ago, asked a question with at least 3 up-votes. For 15 billions reads ... how long ?

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1506 users visited in the last hour