User: sebastien.letort

Reputation:
70
Status:
Trusted
Location:
France
Last seen:
12 months ago
Joined:
3 years, 10 months ago
Email:
s***************@irisa.fr

Posts by sebastien.letort

<prev • 18 results • page 1 of 2 • next >
2
votes
2
answers
451
views
2
answers
Answer: A: Scaffolding contigs generated by minia
... Hi, In [gatb-minia-pipeline][1], the reads are mapped on contigs then the bam is used by [Besst][2] scaffolder. [1]: https://github.com/GATB/gatb-minia-pipeline [2]: https://github.com/ksahlin/BESST ...
written 12 months ago by sebastien.letort70
0
votes
1
answer
349
views
1
answers
Comment: A: DSK: readme and options
... Okay, my mistake. This is clearly not the place to report this problem. Sorry and thanks for not being rough ;) ...
written 15 months ago by sebastien.letort70
6
votes
1
answer
349
views
1
answer
DSK: readme and options
... dsk readme shows command line with -file and -kmer-size. The one I used (no --version, so don't know which) on genouest.org cluster doesn't understand those options. It seems to be only dsk file_in kmer_size. So time for you to update the readme or for me to update dsk ? ...
gatb written 15 months ago by sebastien.letort70 • updated 15 months ago by pierre.peterlongo840
0
votes
0
answers
505
views
0
answers
Comment: C: blastn error values meaning
... So, I isolated the sequence that pose bp (at least one sequence). https://data-access.cesgo.org/index.php/s/drp18eXmrj1a5lL I ran blaster on it -> error value 9 I ran blastn => no error. I'm not used to blaster and not really to blast, so I used the following option conversion : blaster ...
written 19 months ago by sebastien.letort70
0
votes
0
answers
505
views
0
answers
Comment: C: blastn error values meaning
... Yes (how do you know ?) but the error occur also if I run the blaster command alone. I blast chunks of the fasta file to seek for the bad sequence. ...
written 19 months ago by sebastien.letort70
1
vote
0
answers
505
views
0
answers
blastn error values meaning
... Hi, my blast command ends with an error value 9 and I can't find the meaning of it. Can someone give me a clue on what went wrong ? blaster -n blastn -q Boleracea_db/batches/batch_244.fa -s Boleracea_db/Boleracea_chunks.fa -B debug_batch_244.fa -a -S 0 -E 1e-300 -L 100 -I 90 -N -p '-a 1 ' -c - ...
blast error written 19 months ago by sebastien.letort70 • updated 19 months ago by callum_heath0
1
vote
1
answer
718
views
1
answers
Answer: A: CWL: WorkflowException: 'location'
... The error seems to come from the yaml file used as input. The following command works cwl-runner nucmer.cwl --query test.ref.fa --reference test.ref.fa --- Ok I've found what's wrong. Class is 'File' and not 'file'. I suggest to have a more precise output error message. "*No class 'file' exis ...
written 2.4 years ago by sebastien.letort70
0
votes
1
answer
718
views
1
answers
Comment: C: CWL: WorkflowException: 'location'
... They are both fasta files, they exist and the nucmer command alone works well. test.in.fa, 50 seq, 2 lines per seq >scaffold_1 TTTTATTTATTTCTTTTTATCTTTTAATTTTAAAAAATAATATAATTTGACAATATTTTGTTTCTTTTTTTAAAAGATATCGAATATGAAATAATACAATCCTATTGGTTGGTGAACTTAGAGGTTCACCCTAGGAGGTGAACCCAAGAAAAAGTCTTTTG ...
written 2.5 years ago by sebastien.letort70
0
votes
2
answers
752
views
2
answers
Answer: A: cwl stderr management: Not all output in my outfile.
... I'll accept the answer as it provided valuable clue to start a description. But I mention that this description (or my use of it !) leads to [another error][1] : workflowException: 'location' [1]: https://www.biostars.org/p/245340/ ...
written 2.5 years ago by sebastien.letort70
2
votes
1
answer
718
views
1
answer
CWL: WorkflowException: 'location'
... Hi there, Following my previous [post][1] about nucmer description (as my first real prog description), I tried the solution proprosed by Mickael, but I have now another problem. The command nucmer test.ref.fa test.in.fa works fine, but with cwl tool I got a workflow error. Traceback (m ...
cwl exception output nucmer written 2.5 years ago by sebastien.letort70

Latest awards to sebastien.letort

Scholar 2.4 years ago, created an answer that has been accepted. For A: CWL: WorkflowException: 'location'
Student 3.7 years ago, asked a question with at least 3 up-votes. For 15 billions reads ... how long ?

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1208 users visited in the last hour