User: marongiu.luigi

gravatar for marongiu.luigi
Reputation:
340
Status:
Trusted
Location:
Germany, Mannheim, UMM
Last seen:
6 hours ago
Joined:
3 years ago
Email:
m*************@gmail.com

Posts by marongiu.luigi

<prev • 308 results • page 1 of 31 • next >
0
votes
0
answers
133
views
0
answers
Comment: C: Failure in alignment with BWA using fusion reference genome
... BWA is Version: `0.7.17-r1188`. I did nothing else. You might notice that I changed the fields of chrV to match those of the human chromosome, but no improvements. Although unlikely, could the word length of the sequences (excluding the headers) affect the alignment? The human genomes has 80 chara ...
written 6 hours ago by marongiu.luigi340
0
votes
0
answers
133
views
0
answers
Comment: C: Failure in alignment with BWA using fusion reference genome
... - yes - yes - $ grep "chrV" -A 5 -B 5 fusion38-10k.fa --- GGGGGCGGCGCGGGAGCCTGCACGCCGTTGGAGGGTAGAATGACAGGGGGCGGGGACAGAGAGGCGGTCG CGCCCCCGGCCGCGCCAGCCAAGCCCCCAAGGGGGGCGGGGAGCGGGCAATGGAGCGTGACGAAGGGCCC CAGGGCTGACCCCGGCAAACGTGACCCGGGGCTCCGGGGTGACCCAGCCAAGCGTGACCAAGGGGCCCGT GGGTGACACAGG ...
written 1 day ago by marongiu.luigi340 • updated 1 day ago by finswimmer7.8k
0
votes
0
answers
133
views
0
answers
Comment: C: Failure in alignment with BWA using fusion reference genome
... exactly the same error... ...
written 1 day ago by marongiu.luigi340
0
votes
0
answers
133
views
0
answers
Comment: C: Failure in alignment with BWA using fusion reference genome
... That was a good tip that I shall remember, but there no Windows here: $ file GRCh38.fa GRCh38.fa: ASCII text $ file virChr10510.fa virChr10510.fa: ASCII text $ file fusion38-10k.fa fusion38-10k.fa: ASCII text ...
written 3 days ago by marongiu.luigi340
0
votes
0
answers
133
views
0
answers
Comment: C: Failure in alignment with BWA using fusion reference genome
... I also tried with printf "field\t...field\n" but I got the same error. ...
written 4 days ago by marongiu.luigi340
0
votes
0
answers
177
views
0
answers
Comment: C: Hidden reads in IGV
... There was indeed a flaw in the R script I wrote, it was not flushing data properly. Now everything looks good. I am filtering the reads by quality and the coverage is again in more reasonable ranges. Tx ...
written 17 days ago by marongiu.luigi340
0
votes
0
answers
133
views
0
answers
Comment: C: Failure in alignment with BWA using fusion reference genome
... Nope, it did not. I tried with both `sed -i 's/\s*$//g'` (for spaces in the sequence) and `sed -i 's/^[^>]\s*$//g'` (for spaces in the header) followed by `bwa index` but the result was always the sae. ...
written 18 days ago by marongiu.luigi340
0
votes
2
answers
122
views
2
answers
Comment: C: convert paired fastq files to fasta with EMBOSS:seqret or FASTX-toolkit:fastq_to
... My question was if I could use either of these two tools to process the paired files at once. As genomax pointed out, they `Convert fastq to fasta format. Nothing more or less.`, which I understand meaning `no, they can't be used to process both paired files at once`. Hence the next question is: `ho ...
written 18 days ago by marongiu.luigi340
0
votes
0
answers
133
views
0
answers
Comment: C: Failure in alignment with BWA using fusion reference genome
... That would be weird because I could align to the individual genomes individually. How could spaces be introduced by simply concatenating two files? And that post indicates that "spaces in the header are OK". Anyway, I'll try this, thank you. ...
written 18 days ago by marongiu.luigi340
1
vote
0
answers
133
views
0
answers
Failure in alignment with BWA using fusion reference genome
... Dear all, I have used the fasta genome provided by NCBI as reported in this [post][1] . The headers of this file are: >chr1 AC:CM000663.2 gi:568336023 LN:248956422 rl:Chromosome M5:6aef897c3d6ff0c78aff06ac189178dd AS:GRCh38 >chr2 AC:CM000664.2 gi:568336022 LN:242193529 rl:C ...
software error alignment written 18 days ago by marongiu.luigi340

Latest awards to marongiu.luigi

Popular Question 14 days ago, created a question with more than 1,000 views. For Trimmomatic becomes sleeping process
Popular Question 6 weeks ago, created a question with more than 1,000 views. For Trimmomatic becomes sleeping process
Popular Question 7 weeks ago, created a question with more than 1,000 views. For GRCh38 toplevel fasta is empty
Scholar 11 weeks ago, created an answer that has been accepted. For A: Realign BAM files to other reference file
Popular Question 12 weeks ago, created a question with more than 1,000 views. For GRCh38 toplevel fasta is empty
Supporter 3 months ago, voted at least 25 times.
Popular Question 4 months ago, created a question with more than 1,000 views. For GRCh38 toplevel fasta is empty
Teacher 4 months ago, created an answer with at least 3 up-votes. For A: Realign BAM files to other reference file
Popular Question 5 months ago, created a question with more than 1,000 views. For GRCh38 toplevel fasta is empty
Popular Question 7 months ago, created a question with more than 1,000 views. For GRCh38 toplevel fasta is empty
Centurion 8 months ago, created 100 posts.
Popular Question 9 months ago, created a question with more than 1,000 views. For Tophat Building transcriptome files synthax
Popular Question 10 months ago, created a question with more than 1,000 views. For Tophat Building transcriptome files synthax
Popular Question 13 months ago, created a question with more than 1,000 views. For Tophat Building transcriptome files synthax
Popular Question 13 months ago, created a question with more than 1,000 views. For GRCh38 toplevel fasta is empty
Popular Question 18 months ago, created a question with more than 1,000 views. For Tophat Building transcriptome files synthax
Popular Question 18 months ago, created a question with more than 1,000 views. For FastUniq on linux terminal
Scholar 19 months ago, created an answer that has been accepted. For A: align fasta files using bowtie2
Popular Question 2.1 years ago, created a question with more than 1,000 views. For FastUniq on linux terminal

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1734 users visited in the last hour