User: marongiu.luigi

gravatar for marongiu.luigi
Reputation:
450
Status:
Trusted
Location:
Germany, Mannheim, UMM
Last seen:
3 weeks, 5 days ago
Joined:
4 years, 2 months ago
Email:
m*************@gmail.com

Posts by marongiu.luigi

<prev • 421 results • page 1 of 43 • next >
0
votes
1
answer
135
views
1
answers
Comment: C: Blast: do separators matter?
... Ok, it makes sense. And for running a concatenated sequence versus the individual sequences, would the former provide any kind of computational improvement? Thank you ...
written 5 weeks ago by marongiu.luigi450
0
votes
1
answer
135
views
1
answers
Comment: C: Blast: do separators matter?
... No, I would like to know whether this approach is viable or biased. The idea to concatenate was to have more specific results (a slightly better e-value) but also to ease the computation: instead of running blast (which takes a lot of time to run) n times for n sequences, launching it just once with ...
written 5 weeks ago by marongiu.luigi450
0
votes
1
answer
135
views
1
answers
Comment: C: Blast: do separators matter?
... Thank you, so I gather I should use '-' and not 'N' ...
written 5 weeks ago by marongiu.luigi450
3
votes
1
answer
135
views
1
answer
Blast: do separators matter?
... Hello, If I have two sequences like this: > seq 1 CCGCAGTAACGATATCCTTCGCCAGGCTTCCGCTTATTTTGCGAAGGCGGAGTTCGACCG > seq 2 TCAGCAACAGCGACATCATCCGGATAAACGCAGTGCCCGTGCGCAGCGCGATGACTGGCTGAAGAAAGAGATACAGCGCGTATACGATGAAAATCACAAGG that should map on the same organism, and I would like ...
blast use written 5 weeks ago by marongiu.luigi450 • updated 5 weeks ago by Mensur Dlakic3.0k
0
votes
0
answers
167
views
0
answers
Comment: C: best blast strategy: read vs cluster?
... The rationale of generating a consensus was exactly that of overcoming possible divergences against the reference sequence, given the high variability of viruses. Using hard clipped reads to make the consensus would be better? And are the 'N' introducing an error in the blast search? Thank you ...
written 6 weeks ago by marongiu.luigi450
0
votes
0
answers
167
views
0
answers
Comment: C: best blast strategy: read vs cluster?
... Because, in mapping viral sequences, there is the risk of calling viral what is either human or bacterial, thus one needs to run multiple rounds of blast on top of BWA MEM to remove false positives. I have tried to replicate the pipeline that is reported for instance in [Norman et al. Cell 2015][1]: ...
written 6 weeks ago by marongiu.luigi450
0
votes
0
answers
167
views
0
answers
Comment: C: best blast strategy: read vs cluster?
... No, the contigs or clusters I generated. ...
written 6 weeks ago by marongiu.luigi450
0
votes
0
answers
167
views
0
answers
Comment: C: best blast strategy: read vs cluster?
... In the graph, as in reality, I used reads 1,2,3 to make the consensus (contig) 1, then read 4 for contig 2 and reads 5,6 for contig 3, then simply concatenated everything with the spacer 10xN into cluster 1. Shal I re-run making a further consensus with the reference sequence and the three contigs? ...
written 6 weeks ago by marongiu.luigi450
0
votes
0
answers
167
views
0
answers
Comment: C: best blast strategy: read vs cluster?
... the aim is to confirm the mapping of the reads. Apologies for the term `clustal` I always get confused. I only used `clustal omega` to generate the consensuses. All the rest is about `BLAST`. ...
written 6 weeks ago by marongiu.luigi450
0
votes
0
answers
167
views
0
answers
Comment: C: best blast strategy: read vs cluster?
... but then I have to go into thousands of reads to check that. What I have done was to sort the reads by starting point and to call the reads into separate contigs if the starting point of the read n+1 was greater than the end point of the read n. I then used 10 Ns to separate the contigs ...
written 6 weeks ago by marongiu.luigi450

Latest awards to marongiu.luigi

Popular Question 5 weeks ago, created a question with more than 1,000 views. For Trimmomatic becomes sleeping process
Popular Question 5 weeks ago, created a question with more than 1,000 views. For Trimmomatic becomes sleeping process
Popular Question 7 weeks ago, created a question with more than 1,000 views. For Trimmomatic becomes sleeping process
Popular Question 4 months ago, created a question with more than 1,000 views. For Trimmomatic becomes sleeping process
Student 4 months ago, asked a question with at least 3 up-votes. For align fasta files using bowtie2
Popular Question 5 months ago, created a question with more than 1,000 views. For Trimmomatic becomes sleeping process
Popular Question 5 months ago, created a question with more than 1,000 views. For GRCh38 toplevel fasta is empty
Popular Question 5 months ago, created a question with more than 1,000 views. For Trimmomatic becomes sleeping process
Scholar 5 months ago, created an answer that has been accepted. For A: Realign BAM files to other reference file
Popular Question 6 months ago, created a question with more than 1,000 views. For Trimmomatic becomes sleeping process
Popular Question 6 months ago, created a question with more than 1,000 views. For GRCh38 toplevel fasta is empty
Popular Question 7 months ago, created a question with more than 1,000 views. For Trimmomatic becomes sleeping process
Popular Question 7 months ago, created a question with more than 1,000 views. For GRCh38 toplevel fasta is empty
Popular Question 7 months ago, created a question with more than 1,000 views. For whole genome fasta/gtf for cell lines
Popular Question 8 months ago, created a question with more than 1,000 views. For Trimmomatic becomes sleeping process
Popular Question 8 months ago, created a question with more than 1,000 views. For GRCh38 toplevel fasta is empty
Popular Question 9 months ago, created a question with more than 1,000 views. For Trimmomatic becomes sleeping process
Popular Question 9 months ago, created a question with more than 1,000 views. For Trimmomatic becomes sleeping process
Popular Question 11 months ago, created a question with more than 1,000 views. For Trimmomatic becomes sleeping process
Popular Question 11 months ago, created a question with more than 1,000 views. For GRCh38 toplevel fasta is empty
Popular Question 11 months ago, created a question with more than 1,000 views. For Trimmomatic becomes sleeping process
Popular Question 11 months ago, created a question with more than 1,000 views. For Trimmomatic becomes sleeping process
Great Question 11 months ago, created a question with more than 5,000 views. For run FASTQC on linux terminal as java script
Great Question 12 months ago, created a question with more than 5,000 views. For run FASTQC on linux terminal as java script
Popular Question 12 months ago, created a question with more than 1,000 views. For Trimmomatic becomes sleeping process

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1531 users visited in the last hour