User: marongiu.luigi

gravatar for marongiu.luigi
Reputation:
360
Status:
Trusted
Location:
Germany, Mannheim, UMM
Last seen:
7 hours ago
Joined:
3 years, 2 months ago
Email:
m*************@gmail.com

Posts by marongiu.luigi

<prev • 318 results • page 1 of 32 • next >
0
votes
1
answer
115
views
1
answers
Comment: A: how to run freebayes in multi-thread
... I will, but it might take sometimes... ...
written 2 days ago by marongiu.luigi360
0
votes
1
answer
115
views
1
answers
Comment: C: how to run freebayes in multi-thread
... same thing when i changed the shebang to `#!/usr/bin/env python2 ` ...
written 3 days ago by marongiu.luigi360
0
votes
1
answer
115
views
1
answers
Comment: C: how to run freebayes in multi-thread
... I ran: `$ ~/src/freebayes/scripts/frebayes-parallel <(python2 ~/src/freebayes/scripts/fasta_generate_regions.py ~/refSeq/fusion/fusion38-10k.fa.fai) 36 -f ~/refSeq/fusion/fusion38-10k.fa ~/servers/chirexpsrv3_a32/LUIGI_HIPO32_nls/rslt/A1/A1-N_F-AlnSrtDed.bam > ~/Downloads/h32/rslt/A1-N_F.vcf` ...
written 3 days ago by marongiu.luigi360
0
votes
1
answer
115
views
1
answers
Comment: C: how to run freebayes in multi-thread
... I thought I did it by launching freebayes-parallel with its absolute path... ...
written 3 days ago by marongiu.luigi360
0
votes
1
answer
115
views
1
answers
Comment: C: how to run freebayes in multi-thread
... I think the standard is Python 3.7.0 because this is what comes out if I type `python` on the terminal ...
written 3 days ago by marongiu.luigi360
5
votes
1
answer
115
views
1
answer
how to run freebayes in multi-thread
... Dear all, I would like to run freebayes as a multi-thread application. I followed the script given as an example freebayes-parallel < (fasta_generate_regions.py ref.fa.fai 100000) 36 -f ref.fa aln.bam > out.vcf" by writing a command: pathTo/freebayes/scripts/frebayes-parallel <(p ...
vcf multi-thread freebayes written 3 days ago by marongiu.luigi360 • updated 48 minutes ago by RamRS20k
0
votes
1
answer
771
views
1
answers
Comment: C: install Primer3 on Ubuntu
... It worked for me! Thanks ...
written 5 weeks ago by marongiu.luigi360
0
votes
1
answer
252
views
1
answers
Comment: C: Failure in alignment with BWA using fusion reference genome
... I tried to investigate but none of the steps introduced funny characters. It will remain a mistery... ...
written 8 weeks ago by marongiu.luigi360
0
votes
1
answer
252
views
1
answers
Comment: C: Failure in alignment with BWA using fusion reference genome
... The alignment has started! So the problem was indeed about those faulty characters. Case closed. Thank you so much again. ...
written 9 weeks ago by marongiu.luigi360
0
votes
1
answer
252
views
1
answers
Comment: C: Failure in alignment with BWA using fusion reference genome
... Ah, that is very clever! Yes it did find some troubles: $ awk '/[^a-zA-Z]/ && $0 !~"^>" {print "invalid char at line ", NR}' fusion38-10k.fa invalid char at line 44558934 invalid char at line 46471885 $ sed '44558934q;d' fusion38-10k.fa TGCTTAGATGTAAGAGATAAACATTTAAA ...
written 9 weeks ago by marongiu.luigi360

Latest awards to marongiu.luigi

Great Question 2 days ago, created a question with more than 5,000 views. For run FASTQC on linux terminal as java script
Great Question 5 weeks ago, created a question with more than 5,000 views. For run FASTQC on linux terminal as java script
Popular Question 5 weeks ago, created a question with more than 1,000 views. For Trimmomatic becomes sleeping process
Popular Question 8 weeks ago, created a question with more than 1,000 views. For Trimmomatic becomes sleeping process
Popular Question 8 weeks ago, created a question with more than 1,000 views. For GRCh38 toplevel fasta is empty
Popular Question 8 weeks ago, created a question with more than 1,000 views. For whole genome fasta/gtf for cell lines
Popular Question 12 weeks ago, created a question with more than 1,000 views. For Trimmomatic becomes sleeping process
Popular Question 3 months ago, created a question with more than 1,000 views. For Trimmomatic becomes sleeping process
Popular Question 4 months ago, created a question with more than 1,000 views. For GRCh38 toplevel fasta is empty
Scholar 5 months ago, created an answer that has been accepted. For A: Realign BAM files to other reference file
Popular Question 5 months ago, created a question with more than 1,000 views. For GRCh38 toplevel fasta is empty
Supporter 6 months ago, voted at least 25 times.
Popular Question 7 months ago, created a question with more than 1,000 views. For GRCh38 toplevel fasta is empty
Teacher 7 months ago, created an answer with at least 3 up-votes. For A: Realign BAM files to other reference file
Popular Question 8 months ago, created a question with more than 1,000 views. For GRCh38 toplevel fasta is empty
Popular Question 9 months ago, created a question with more than 1,000 views. For GRCh38 toplevel fasta is empty
Centurion 10 months ago, created 100 posts.
Popular Question 11 months ago, created a question with more than 1,000 views. For Tophat Building transcriptome files synthax
Popular Question 13 months ago, created a question with more than 1,000 views. For Tophat Building transcriptome files synthax
Popular Question 16 months ago, created a question with more than 1,000 views. For Tophat Building transcriptome files synthax
Popular Question 16 months ago, created a question with more than 1,000 views. For GRCh38 toplevel fasta is empty
Popular Question 21 months ago, created a question with more than 1,000 views. For Tophat Building transcriptome files synthax
Popular Question 21 months ago, created a question with more than 1,000 views. For FastUniq on linux terminal
Scholar 21 months ago, created an answer that has been accepted. For A: align fasta files using bowtie2
Popular Question 2.3 years ago, created a question with more than 1,000 views. For FastUniq on linux terminal

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2292 users visited in the last hour