User: mittu1602

gravatar for mittu1602
mittu1602140
Reputation:
140
Status:
Trusted
Location:
India
Last seen:
1 week, 2 days ago
Joined:
2 years, 2 months ago
Email:
m********@gmail.com

Posts by mittu1602

<prev • 82 results • page 1 of 9 • next >
0
votes
0
answers
125
views
0
answers
Comment: C: No RS id was called in vcf file after giving dbsnp command
... Please post your GATK command, and please be careful of your post ...
written 9 days ago by mittu1602140
0
votes
0
answers
104
views
0
answers
Genome Studio confusing SNP allele coding schema, what is the main genotype of the sample?
... Hello All, Many similar questions are earlier discussed here, but the confusion still remains same for me. Example from Output file of Genome Studio: SNP rs2986164 Sample XYZ Allele1-Top A Allele2-Top G Allele1-Forward A Allele2-Forward G Allele1-Design T Allele2-Des ...
illumina genomestudio written 17 days ago by mittu1602140
0
votes
4
answers
178
views
4
answers
Comment: C: HOw to merge multifasta sequence into a single sequence having only one header?
... @majeedaasim please choose the accept answer option if it works for you, It will help us motivated. Good Luck! ...
written 28 days ago by mittu1602140
1
vote
4
answers
178
views
4
answers
Answer: A: HOw to merge multifasta sequence into a single sequence having only one header?
... grep -v "^>" test.fasta | awk 'BEGIN { ORS=""; print ">My_New_Sequence_name\n" } { print }' > new​.fasta test.fasta >seq1 AAAATTGGG >seq2 GGCCCTTTT >seq3 AAATGGGG new.fasta >My_New_Sequence_name AAAATTGGGGGCCCTTTTAAATGGGG ...
written 29 days ago by mittu1602140
0
votes
1
answer
158
views
1
answers
Comment: C: How to use NCBI Gnomon?
... Good luck! Good to update the answer ...
written 6 weeks ago by mittu1602140
1
vote
1
answer
158
views
1
answers
Answer: A: How to use NCBI Gnomon?
... This post can help [Gnomon][1] [1]: https://www.biostars.org/p/144013/ ...
written 7 weeks ago by mittu1602140
0
votes
1
answer
217
views
1
answers
Comment: C: Query regarding BLASTKOALA (KEGG) for pathway annotation
... Yes, @natasha you are correct. I have been working on BlastKOALA for a very long time now. It is tiring but fetched good result. You need to split files and make small chunks @sharmatina189059 ...
written 7 weeks ago by mittu1602140
0
votes
1
answer
516
views
1
answers
Answer: A: How to merge two files genotype and ped In Linux? I sample files as follows.
... You can try awk one-liner cat Test1.txt S949C08 111071 900533 900409 Susceptible 2 S949G08 111064 900533 900469 Susceptible 2 S949E09 111051 910054 890231 Susceptible 2 S949209 111049 910054 910087 Susceptible 2 R949C06 111034 920283 920207 Susceptible 1 cat Test2.txt R9 ...
written 7 weeks ago by mittu1602140
0
votes
1
answer
183
views
1
answers
Comment: C: Matching complementary genotypes from 2 different files
... Thank you so much @Kevin it really worked and helped me. Much appreciated for your time over this! Can u also suggest me that if I can use it as a shell script? Happy New Year! ...
written 7 weeks ago by mittu1602140
0
votes
1
answer
183
views
1
answers
Comment: C: Matching complementary genotypes from 2 different files
... for this example only, wanted to bold them to stand out! ...
written 7 weeks ago by mittu1602140

Latest awards to mittu1602

Scholar 7 weeks ago, created an answer that has been accepted. For A: SAMtools installation on windows
Scholar 9 weeks ago, created an answer that has been accepted. For A: SAMtools installation on windows
Supporter 9 weeks ago, voted at least 25 times.
Scholar 3 months ago, created an answer that has been accepted. For A: SAMtools installation on windows
Popular Question 5 months ago, created a question with more than 1,000 views. For pathway database KEGG and REACTOME

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1805 users visited in the last hour