User: mittu1602

gravatar for mittu1602
mittu1602150
Reputation:
150
Status:
Trusted
Location:
India
Last seen:
7 months ago
Joined:
2 years, 11 months ago
Email:
m********@gmail.com

Posts by mittu1602

<prev • 84 results • page 1 of 9 • next >
0
votes
3
answers
2.0k
views
3
answers
Answer: A: Issue converting VCF to MAF using snpEff annotations
... Hi have you installed vep tool well? and to my notice vep needs a particular perl version only. Please verify that too. ...
written 7 months ago by mittu1602150
0
votes
2
answers
392
views
2
answers
Answer: A: How to fix .bam file that was diagnosed as "MISSING_READ_GROUP" by Picard Valida
... Hi Jung, Missing read groups occur because either your machine could not capture the reads, or the quality cutoffs are too high where those reads were removed. You can try decreasing your quality score. This is best to my knowledge. ...
written 7 months ago by mittu1602150
0
votes
0
answers
440
views
0
answers
Comment: C: No RS id was called in vcf file after giving dbsnp command
... Please post your GATK command, and please be careful of your post ...
written 9 months ago by mittu1602150
0
votes
0
answers
485
views
0
answers
Genome Studio confusing SNP allele coding schema, what is the main genotype of the sample?
... Hello All, Many similar questions are earlier discussed here, but the confusion still remains same for me. Example from Output file of Genome Studio: SNP rs2986164 Sample XYZ Allele1-Top A Allele2-Top G Allele1-Forward A Allele2-Forward G Allele1-Design T Allele2-Des ...
illumina genomestudio written 9 months ago by mittu1602150
0
votes
4
answers
1.2k
views
4
answers
Comment: C: HOw to merge multifasta sequence into a single sequence having only one header?
... @majeedaasim please choose the accept answer option if it works for you, It will help us motivated. Good Luck! ...
written 10 months ago by mittu1602150
1
vote
4
answers
1.2k
views
4
answers
Answer: A: HOw to merge multifasta sequence into a single sequence having only one header?
... grep -v "^>" test.fasta | awk 'BEGIN { ORS=""; print ">My_New_Sequence_name\n" } { print }' > new​.fasta test.fasta >seq1 AAAATTGGG >seq2 GGCCCTTTT >seq3 AAATGGGG new.fasta >My_New_Sequence_name AAAATTGGGGGCCCTTTTAAATGGGG ...
written 10 months ago by mittu1602150
0
votes
1
answer
465
views
1
answers
Comment: C: How to use NCBI Gnomon?
... Good luck! Good to update the answer ...
written 10 months ago by mittu1602150
1
vote
1
answer
465
views
1
answers
Answer: A: How to use NCBI Gnomon?
... This post can help [Gnomon][1] [1]: https://www.biostars.org/p/144013/ ...
written 10 months ago by mittu1602150
0
votes
1
answer
513
views
1
answers
Comment: C: Query regarding BLASTKOALA (KEGG) for pathway annotation
... Yes, @natasha you are correct. I have been working on BlastKOALA for a very long time now. It is tiring but fetched good result. You need to split files and make small chunks @sharmatina189059 ...
written 10 months ago by mittu1602150
0
votes
1
answer
837
views
1
answers
Answer: A: How to merge two files genotype and ped In Linux? I sample files as follows.
... You can try awk one-liner cat Test1.txt S949C08 111071 900533 900409 Susceptible 2 S949G08 111064 900533 900469 Susceptible 2 S949E09 111051 910054 890231 Susceptible 2 S949209 111049 910054 910087 Susceptible 2 R949C06 111034 920283 920207 Susceptible 1 cat Test2.txt R9 ...
written 10 months ago by mittu1602150

Latest awards to mittu1602

Scholar 10 months ago, created an answer that has been accepted. For A: SAMtools installation on windows
Scholar 11 months ago, created an answer that has been accepted. For A: SAMtools installation on windows
Supporter 11 months ago, voted at least 25 times.
Scholar 12 months ago, created an answer that has been accepted. For A: SAMtools installation on windows
Popular Question 14 months ago, created a question with more than 1,000 views. For pathway database KEGG and REACTOME

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1649 users visited in the last hour