User: san.san

gravatar for san.san
san.san90
Reputation:
90
Status:
New User
Location:
Wales, UK
Last seen:
2 years, 3 months ago
Joined:
3 years ago
Email:
s**********@gmail.com

Posts by san.san

<prev • 23 results • page 1 of 3 • next >
0
votes
3
answers
1.1k
views
3
answers
Comment: C: Renaming fasta file according to a name list (blast output)
... I'm wondering, how do I order my sequences to be `>ASSI-1_0` then `>ASSI-2_1` rather than `>ASSI-1_0` and then `>STE-100000_218031`? ...
written 2.5 years ago by san.san90
0
votes
3
answers
1.1k
views
3
answers
Comment: C: Renaming fasta file according to a name list (blast output)
... I just realised why it didn't work. Because I used blast output file that included other columns apart from the first two. ...
written 2.5 years ago by san.san90
0
votes
3
answers
1.1k
views
3
answers
Comment: C: Renaming fasta file according to a name list (blast output)
... I'm getting this when I run it: >STE-1_0 TCTTAACTCATTGTGTGTGTATGCC >STE-100000_218031 scaf0293423_20071.471 >STE-10000_10255 TCTGGAAAATAAAGCGGTCCACCCC >STE-100001_218032 scaf0391581 I wonder if it's because some blast outputs are like so: STE-12125 ...
written 2.5 years ago by san.san90
0
votes
3
answers
1.1k
views
3
answers
Comment: C: Renaming fasta file according to a name list (blast output)
... Would this command work when not all my sequences in the my.fasta file had a blast hit? ...
written 2.5 years ago by san.san90
5
votes
3
answers
1.1k
views
3
answers
Renaming fasta file according to a name list (blast output)
... I need to rename a fasta file according to a blast output file where my fasta was a query. Not all sequences had a hit. **my.fasta:** >ASSI-1_0 TTCCTTTTTGGTTCTCGATATTATGAACAGTTTCTCATCA >ASSI-2_1 GTGAGGGAGGAGGACGCCTCGAGCAGAGGTAGGTCTGGAG >ASSI-3_2 ATGTTAGCAAGTATAG ...
fasta sequence command-line written 2.5 years ago by san.san90 • updated 2.5 years ago by shenwei3564.5k
8
votes
2
answers
2.9k
views
2
answers
Manual edit of multiple alignment
... I've been asked to align and manually edit some sequences for a phylogenetic analysis. I've aligned my data with ClustalW and MAFFT for comparison and spent several hours trying to figure out how to manually edit these alignments. I'm at a loss. I thought I'd need trim the ends of the alignments t ...
alignment sequence written 2.8 years ago by san.san90 • updated 4 months ago by al-ash100
0
votes
0
answers
1.5k
views
0
answers
Comment: C: abyss fixmate error
... It may be because your left and right reads are very different sizes. I got the same error after Trimmomatic discarded most of my left reads. ...
written 2.9 years ago by san.san90
0
votes
0
answers
720
views
0
answers
Comment: C: Specify a different temporary file directory in SGE
... Thank you for pointing me in the right direction! ...
written 2.9 years ago by san.san90
0
votes
0
answers
720
views
0
answers
(Closed) Specify a different temporary file directory in SGE
... I'm running out of disk space on /tmp on nodes and have been advised to specify my scratch directory for temp files. The only thing is that I'm not sure how to do that and all the answers I came across online require some previous knowledge. I tried adding `#$ -v TMPDIR=/my/scratch/` to my script b ...
parallel sge written 2.9 years ago by san.san90
1
vote
5
answers
6.4k
views
5
answers
Answer: A: Renaming fasta headers according to a matching name list
... This is another solution that was proposed to me, if anyone finds it helpful: awk 'FNR==NR{ a[">"$1]=$2;next } $1 in a{ sub(/>/,">"a[$1]"|",$1) }1' names.txt seq.fa ...
written 3.0 years ago by san.san90

Latest awards to san.san

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1318 users visited in the last hour