User: Buffo

gravatar for Buffo
Buffo1.6k
Reputation:
1,590
Status:
Trusted
Location:
Last seen:
1 week, 3 days ago
Joined:
3 years, 3 months ago
Email:
c****************@hotmail.com

Posts by Buffo

<prev • 317 results • page 1 of 32 • next >
0
votes
1
answer
109
views
1
answers
Answer: A: sam flag count
... [Decoding sam flags][1] [ Edited link (https://www.biostars.org/u/25721/) ] [1]: http://broadinstitute.github.io/picard/explain-flags.html ...
written 18 days ago by Buffo1.6k • updated 18 days ago by ATpoint19k
1
vote
1
answer
78
views
1
answers
Answer: A: Gene Expression Normalized values
... No, TMM values are the read-count normalized. With RNAseq data, you can calculate the relative abundance levels of the whole transcriptome by calculating the FPKM, RPKM or TPM, or if you have control samples you can also determine the fold of change of each transcript/gene against the control. I rec ...
written 18 days ago by Buffo1.6k
0
votes
1
answer
128
views
1
answers
Answer: A: WGCNA: How to plot gene-trait correlation heatmap
... It looks like [complexHeatmap][1] [1]: https://bioconductor.statistik.tu-dortmund.de/packages/3.1/bioc/vignettes/ComplexHeatmap/inst/doc/ComplexHeatmap.html ...
written 22 days ago by Buffo1.6k
1
vote
1
answer
81
views
1
answers
Answer: A: Pipeline validating in miRNA studies
... Why choose mirwalk? I recommend you to read this article: [Tools for Sequence-Based miRNA Target Prediction: What to Choose?][1] before to perform any unjustified pipeline. It summarizes the most popular and available algorithms for target prediction. [1]: https://www.ncbi.nlm.nih.gov/pmc/articl ...
written 29 days ago by Buffo1.6k
0
votes
2
answers
139
views
2
answers
Answer: A: genome sequence from Spades output
... It looks like you do not have sequenced the entire sequence, so you can't get it. ...
written 4 weeks ago by Buffo1.6k
0
votes
2
answers
179
views
2
answers
Comment: C: miRna-Seq, featureCounts problem
... The mature product from these two hairpins is identical (UAGCACCAUUUGAAAUCAGUGUU) and thus indistinguishable from sequence That is not a new debate, it is an old question about isomirs, and again, if you map your reads against mirbase files you will count multi-hit reads as single. If you consi ...
written 5 weeks ago by Buffo1.6k
0
votes
2
answers
179
views
2
answers
Comment: C: miRna-Seq, featureCounts problem
... So given a miRNA with two identical copies in the genome No sense! it does not exist. You don't understand what redundant sequence is. but we have no way of knowing which copy it came from? Yes, we can, mapping to the genome. Fair enough, we have been mapping to Rfam rather than mirb ...
written 5 weeks ago by Buffo1.6k
0
votes
2
answers
179
views
2
answers
Comment: C: miRna-Seq, featureCounts problem
... If miR-X is encoded in two places in the genome, then a read from miR-X will always be multi-mapped. That is exactly why you should use bowtie instead of bowtie2 and sequences of high quality. Pipelines will then either ignore this read, or count it twice (once for miR-Xa and miR-Xb) I p ...
written 5 weeks ago by Buffo1.6k
0
votes
2
answers
179
views
2
answers
Answer: A: miRna-Seq, featureCounts problem
... In addition to i.sudbery answer, I recommend you to map the reads against the genome, not against the mature/hairpin sequences. This second pipeline cause biased analysis since some of the actually known miRNAs are redundant in sequence (especially in mouse). ...
written 5 weeks ago by Buffo1.6k
0
votes
0
answers
209
views
0
answers
Comment: A: de novo assembly of raw illumina reads of RNA seq experiment (24gb data)
... Having an internet connection is a very different thing of having a connection to a private server. But additionally, if you spend money in an NGS experiment why not spend a bit more contacting a professional bioinformatics analyst? NGS projects may be translated into large and interesting results i ...
written 7 weeks ago by Buffo1.6k

Latest awards to Buffo

Teacher 29 days ago, created an answer with at least 3 up-votes. For A: How can I get FASTA if i have Names of proteins ?
Popular Question 7 weeks ago, created a question with more than 1,000 views. For piRNA target-interaction database?
Teacher 9 weeks ago, created an answer with at least 3 up-votes. For A: How can I get FASTA if i have Names of proteins ?
Appreciated 4 months ago, created a post with more than 5 votes. For A: Which is better: webgestalt vs david?
Scholar 4 months ago, created an answer that has been accepted. For A: How can I get FASTA if i have Names of proteins ?
Teacher 4 months ago, created an answer with at least 3 up-votes. For A: How can I get FASTA if i have Names of proteins ?
Appreciated 4 months ago, created a post with more than 5 votes. For A: Which is better: webgestalt vs david?
Scholar 4 months ago, created an answer that has been accepted. For A: How can I get FASTA if i have Names of proteins ?
Teacher 4 months ago, created an answer with at least 3 up-votes. For A: How can I get FASTA if i have Names of proteins ?
Popular Question 7 months ago, created a question with more than 1,000 views. For Pipeline for genome annotation?
Commentator 7 months ago, created a comment with at least 3 up-votes. For A: GO analysis of Soybean
Popular Question 8 months ago, created a question with more than 1,000 views. For Pipeline for genome annotation?
Commentator 9 months ago, created a comment with at least 3 up-votes. For A: GO analysis of Soybean
Popular Question 9 months ago, created a question with more than 1,000 views. For Pipeline for genome annotation?
Popular Question 10 months ago, created a question with more than 1,000 views. For Pipeline for genome annotation?
Popular Question 11 months ago, created a question with more than 1,000 views. For Pipeline for genome annotation?
Popular Question 11 months ago, created a question with more than 1,000 views. For piRNA target-interaction database?
Popular Question 11 months ago, created a question with more than 1,000 views. For piRNA target-interaction database?
Popular Question 13 months ago, created a question with more than 1,000 views. For piRNA target-interaction database?
Guru 15 months ago, received more than 100 upvotes.
Scholar 16 months ago, created an answer that has been accepted. For A: How can I get FASTA if i have Names of proteins ?
Teacher 16 months ago, created an answer with at least 3 up-votes. For A: How can I get FASTA if i have Names of proteins ?
Teacher 16 months ago, created an answer with at least 3 up-votes. For A: How to convert GTF to gff file for read count using HTSeq
Scholar 16 months ago, created an answer that has been accepted. For A: How can I get FASTA if i have Names of proteins ?
Teacher 16 months ago, created an answer with at least 3 up-votes. For A: How can I get FASTA if i have Names of proteins ?

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 566 users visited in the last hour