User: grant.hovhannisyan

Reputation:
1,390
Status:
Trusted
Location:
Last seen:
14 hours ago
Joined:
2 years, 10 months ago
Email:
g*****************@gmail.com

Posts by grant.hovhannisyan

<prev • 311 results • page 1 of 32 • next >
1
vote
0
answers
138
views
0
answers
Comment: C: for low coverage RNAseq how many reads assigned is the bare minimum for differen
... For reference https://academic.oup.com/bioinformatics/article/30/3/301/228651 ...
written 4 days ago by grant.hovhannisyan1.4k
0
votes
1
answer
76
views
1
answers
Comment: C: Unequally pooling libraries for RNAseq?
... Don't you think that contamination actually could have caused changes in genes expression levels? Will your further comparisons will make sense biologically? ...
written 10 days ago by grant.hovhannisyan1.4k
0
votes
1
answer
172
views
1
answers
Comment: C: Differential Expression of Single Gene
... this could have been a (bad though) solution for the problem, but you have to normalize by sequencing depth. Otherwise the counts for 1 gene don't tell you anything. ...
written 18 days ago by grant.hovhannisyan1.4k
0
votes
1
answer
128
views
1
answers
Comment: C: unmapped reads with pysam
... Accepted :) Thank you! ...
written 18 days ago by grant.hovhannisyan1.4k
3
votes
1
answer
128
views
1
answer
unmapped reads with pysam
... I have a bam file produces by BWA-MEM. It has some unmapped reads, e.g. D00733:389:CD1T7ANXX:3:1101:1572:2235 77 * 0 0 * * 0 0 CAGTTTCACTGTATAAATTGCTTATACTTAGACATGCATGGCTTAATCTT AAB=AFGDGCFFGGGGGGGGGCGGGGGGGGGGGGGGGGGGGGGGGGGGGF AS:i:0 XS:i:0 D00733:389:CD1T7ANXX:3:1101:1572:2235 141 * 0 0 ...
pysam written 18 days ago by grant.hovhannisyan1.4k
2
votes
2
answers
169
views
2
answers
Comment: C: Is Dell Precision mobile workstation suitable for bioinformatics/NGS analysis
... For playing around with data its fine, but with 2 TB you might feel limited in close future. ...
written 4 weeks ago by grant.hovhannisyan1.4k
2
votes
1
answer
184
views
1
answers
Comment: C: Alignment loop using STAR
... Look at the log files of the iteration at which the loop breaks. I suspect that you run out of memory when sorting the bam file. ...
written 5 weeks ago by grant.hovhannisyan1.4k
2
votes
3
answers
188
views
3
answers
Answer: A: Relation between Log2 Fold change and Log2 TPM in RNA-seq data
... Don't compare these two units - its not apples to apples comparison. TMP is a unit of expression. Fold Change is a unit showing how much TPM has changed in one condition compared to another condition. ...
written 5 weeks ago by grant.hovhannisyan1.4k
0
votes
0
answers
1.7k
views
0
answers
Comment: C: Using Fastqc To Check The Quality Of High Throughput Sequence
... really? in bioinformatics forum?:) you get more clicks by posting this under any youtube video with cats ...
written 7 weeks ago by grant.hovhannisyan1.4k
0
votes
2
answers
184
views
2
answers
Answer: A: Can logCPM in edgeR be used to compare expression of different genes within samp
... For any adequate within-sample comparison you need a measure that takes into account the feature length, so the short answer is no. You can use TMP unit. For more details https://haroldpimentel.wordpress.com/2014/05/08/what-the-fpkm-a-review-rna-seq-expression-units/ ...
written 7 weeks ago by grant.hovhannisyan1.4k

Latest awards to grant.hovhannisyan

Popular Question 5 weeks ago, created a question with more than 1,000 views. For Technical replicates in RNAseq
Appreciated 8 weeks ago, created a post with more than 5 votes. For Technical replicates in RNAseq
Good Question 8 weeks ago, asked a question that was upvoted at least 5 times. For Technical replicates in RNAseq
Popular Question 10 weeks ago, created a question with more than 1,000 views. For Read counts of STAR with gff file
Popular Question 11 weeks ago, created a question with more than 1,000 views. For Technical replicates in RNAseq
Scholar 3 months ago, created an answer that has been accepted. For A: Change sequence in SEQIO
Popular Question 4 months ago, created a question with more than 1,000 views. For Technical replicates in RNAseq
Scholar 4 months ago, created an answer that has been accepted. For A: Change sequence in SEQIO
Scholar 4 months ago, created an answer that has been accepted. For A: Change sequence in SEQIO
Teacher 4 months ago, created an answer with at least 3 up-votes. For C: weird STAR output, bash scripting problem
Scholar 5 months ago, created an answer that has been accepted. For A: Change sequence in SEQIO
Guru 6 months ago, received more than 100 upvotes.
Student 6 months ago, asked a question with at least 3 up-votes. For Technical replicates in RNAseq
Popular Question 7 months ago, created a question with more than 1,000 views. For Technical replicates in RNAseq
Scholar 8 months ago, created an answer that has been accepted. For A: Change sequence in SEQIO
Teacher 8 months ago, created an answer with at least 3 up-votes. For C: weird STAR output, bash scripting problem
Commentator 8 months ago, created a comment with at least 3 up-votes. For C: gatk tool installation problem
Popular Question 9 months ago, created a question with more than 1,000 views. For Read counts of STAR with gff file
Scholar 10 months ago, created an answer that has been accepted. For A: Change sequence in SEQIO
Teacher 10 months ago, created an answer with at least 3 up-votes. For C: weird STAR output, bash scripting problem
Teacher 11 months ago, created an answer with at least 3 up-votes. For C: weird STAR output, bash scripting problem
Commentator 11 months ago, created a comment with at least 3 up-votes. For C: gatk tool installation problem
Teacher 11 months ago, created an answer with at least 3 up-votes. For C: weird STAR output, bash scripting problem
Scholar 11 months ago, created an answer that has been accepted. For A: Change sequence in SEQIO
Scholar 11 months ago, created an answer that has been accepted. For A: Change sequence in SEQIO

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1656 users visited in the last hour